Human GDF10/BIP/BMP-3b ORF/cDNA clone-Lentivirus plasmid (NM_004962)

Cat. No.: pGMLP001776
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human GDF10/BIP/BMP-3b Lentiviral expression plasmid for GDF10 lentivirus packaging, GDF10 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to GDF10/BIP products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $702.36
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001776
Gene Name GDF10
Accession Number NM_004962
Gene ID 2662
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1437 bp
Gene Alias BIP,BMP-3b,BMP3B
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCTCATGTCCCCGCTCGGACCAGCCCGGGACCCGGGCCCCAGCTGCTGCTGCTGCTGCTGCCGTTGTTTCTGCTGTTGCTCCGGGATGTGGCCGGCAGCCACAGGGCCCCCGCCTGGTCCGCACTGCCCGCGGCCGCCGACGGCCTGCAGGGGGACAGGGATCTCCAGCGGCACCCTGGGGACGCGGCCGCCACGTTGGGCCCCAGCGCCCAGGACATGGTCGCTGTCCACATGCACAGGCTCTATGAGAAGTACAGCCGGCAGGGCGCGCGGCCGGGAGGGGGCAACACGGTCCGCAGCTTCAGGGCCAGGCTGGAAGTGGTCGACCAGAAGGCCGTGTATTTCTTCAACCTGACTTCCATGCAAGACTCGGAAATGATCCTTACGGCCACTTTCCACTTCTACTCAGAGCCGCCTCGGTGGCCTCGAGCGCTCGAGGTGCTATGCAAGCCGCGGGCCAAGAACGCTTCAGGCCGCCCGCTGCCCCTGGGCCCGCCCACACGCCAGCACCTGCTCTTCCGCAGCCTCTCGCAGAACACGGCCACACAGGGGCTACTCCGCGGGGCCATGGCCCTGGCGCCCCCACCGCGCGGCCTGTGGCAGGCCAAGGACATCTCCCCCATCGTCAAGGCGGCCCGCCGGGATGGCGAGCTGCTCCTCTCCGCCCAGCTGGATTCTGAGGAGAGGGACCCGGGGGTGCCCCGGCCCAGCCCCTATGCGCCCTACATCCTAGTCTATGCCAACGATCTGGCCATCTCGGAGCCCAACAGCGTGGCAGTGACGCTGCAGAGATACGACCCCTTCCCTGCCGGAGACCCCGAGCCCCGCGCAGCCCCCAACAACTCAGCGGACCCCCGCGTGCGCCGAGCCGCGCAGGCCACTGGGCCCCTCCAGGACAACGAGCTGCCGGGGCTGGATGAGAGGCCGCCGCGCGCCCACGCACAGCACTTCCACAAGCACCAGCTGTGGCCCAGCCCCTTCCGGGCGCTGAAACCCCGGCCAGGGCGCAAAGACCGCAGGAAGAAGGGCCAGGAGGTGTTCATGGCCGCCTCGCAGGTGCTGGACTTTGACGAGAAGACGATGCAGAAAGCCCGGAGGAAGCAGTGGGATGAGCCGAGGGTGTGCTCCCGGAGGTACCTGAAGGTGGACTTCGCAGACATCGGCTGGAATGAATGGATAATCTCACCGAAATCTTTTGATGCCTACTACTGCGCGGGAGCATGTGAGTTCCCCATGCCTAAGATCGTTCGTCCATCCAACCATGCCACCATCCAGAGCATTGTCAGGGCTGTGGGCATCATCCCTGGCATCCCAGAGCCCTGCTGTGTTCCCGATAAGATGAACTCCCTTGGGGTCCTCTTCCTGGATGAGAATCGGAATGTGGTTCTGAAGGTGTACCCCAACATGTCCGTGGACACCTGTGCCTGCCGGTGA
ORF Protein Sequence MAHVPARTSPGPGPQLLLLLLPLFLLLLRDVAGSHRAPAWSALPAAADGLQGDRDLQRHPGDAAATLGPSAQDMVAVHMHRLYEKYSRQGARPGGGNTVRSFRARLEVVDQKAVYFFNLTSMQDSEMILTATFHFYSEPPRWPRALEVLCKPRAKNASGRPLPLGPPTRQHLLFRSLSQNTATQGLLRGAMALAPPPRGLWQAKDISPIVKAARRDGELLLSAQLDSEERDPGVPRPSPYAPYILVYANDLAISEPNSVAVTLQRYDPFPAGDPEPRAAPNNSADPRVRRAAQATGPLQDNELPGLDERPPRAHAQHFHKHQLWPSPFRALKPRPGRKDRRKKGQEVFMAASQVLDFDEKTMQKARRKQWDEPRVCSRRYLKVDFADIGWNEWIISPKSFDAYYCAGACEFPMPKIVRPSNHATIQSIVRAVGIIPGIPEPCCVPDKMNSLGVLFLDENRNVVLKVYPNMSVDTCACR

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0939-Ab Anti-GDF10/ BIP/ BMP-3b functional antibody
    Target Antigen GM-Tg-g-SE0939-Ag GDF10 protein
    Cytokine cks-Tg-g-GM-SE0939 growth differentiation factor 10 (GDF10) protein & antibody
    ORF Viral Vector pGMLP001776 Human GDF10 Lentivirus plasmid
    ORF Viral Vector vGMLP001776 Human GDF10 Lentivirus particle


    Target information

    Target ID GM-SE0939
    Target Name GDF10
    Gene ID 2662, 14560, 711441, 79216, 101087525, 611168, 539510, 100063615
    Gene Symbol and Synonyms BIP,BMP-3b,BMP3B,GDF10
    Uniprot Accession P55107
    Uniprot Entry Name GDF10_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000266524
    Target Classification Not Available

    This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This promotes neural repair after stroke. Additionally, this protein may act as a tumor suppressor and reduced expression of this gene is associated with oral cancer. [provided by RefSeq, Jul 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.