Human AMN/amnionless/PRO1028 ORF/cDNA clone-Lentivirus plasmid (NM_030943)

Cat. No.: pGMLP001763
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human AMN/amnionless/PRO1028 Lentiviral expression plasmid for AMN lentivirus packaging, AMN lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to AMN/amnionless products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $681.36
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001763
Gene Name AMN
Accession Number NM_030943
Gene ID 81693
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1362 bp
Gene Alias amnionless,PRO1028
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGCGTCCTGGGCCGGGTCCTGCTGTGGCTGCAGCTCTGCGCACTGACCCAGGCGGTCTCCAAACTCTGGGTCCCCAACACGGACTTCGACGTCGCAGCCAACTGGAGCCAGAACCGGACCCCGTGCGCCGGCGGCGCCGTTGAGTTCCCGGCGGACAAGATGGTGTCAGTCCTGGTGCAAGAAGGTCACGCCGTCTCAGACATGCTCCTGCCGCTGGATGGGGAACTCGTCCTGGCTTCAGGAGCCGGATTCGGCGTCTCAGACGTGGGCTCGCACCTGGACTGTGGCGCGGGCGAACCTGCCGTCTTCCGCGACTCTGACCGCTTCTCCTGGCATGACCCGCACCTGTGGCGCTCTGGGGACGAGGCACCTGGCCTCTTCTTCGTGGACGCCGAGCGCGTGCCCTGCCGCCACGACGACGTCTTCTTTCCGCCTAGTGCCTCCTTCCGCGTGGGGCTCGGCCCTGGCGCTAGCCCCGTGCGTGTCCGCAGCATCTCGGCTCTGGGCCGGACGTTCACGCGCGACGAGGACCTGGCTGTTTTCCTGGCGTCCCGCGCGGGCCGCCTACGCTTCCACGGGCCGGGCGCGCTGAGCGTGGGCCCCGAGGACTGCGCGGACCCGTCGGGCTGCGTCTGCGGCAACGCGGAGGCGCAGCCGTGGATCTGCGCGGCCCTGCTCCAGCCCCTGGGCGGCCGCTGCCCCCAGGCCGCCTGCCACAGCGCCCTCCGGCCCCAGGGGCAGTGCTGTGACCTCTGTGGAGCCGTTGTGTTGCTGACCCACGGCCCCGCATTTGACCTGGAGCGGTACCGGGCGCGGATACTGGACACCTTCCTGGGTCTGCCTCAGTACCACGGGCTGCAGGTGGCCGTGTCCAAGGTGCCACGCTCGTCCCGGCTCCGTGAGGCCGATACGGAGATCCAGGTGGTGCTGGTGGAGAATGGGCCCGAGACAGGCGGAGCGGGGCGGCTGGCCCGGGCCCTCCTGGCGGACGTCGCCGAGAACGGCGAGGCCCTCGGCGTCCTGGAGGCGACCATGCGGGAGTCGGGCGCACACGTCTGGGGCAGCTCCGCGGCTGGGCTGGCGGGCGGCGTGGCGGCTGCCGTGCTGCTGGCGCTGCTGGTCCTGCTGGTGGCGCCGCCGCTGCTGCGCCGCGCGGGGAGGCTCAGGTGGAGGAGGCACGAGGCGGCGGCCCCGGCTGGAGCGCCCCTCGGCTTCCGCAACCCGGTGTTCGACGTGACGGCCTCCGAGGAGCTGCCCCTGCCGCGGCGGCTCAGCCTGGTTCCGAAGGCGGCCGCAGACAGCACCAGCCACAGTTACTTCGTCAACCCTCTGTTCGCCGGGGCCGAGGCCGAGGCCTGA
ORF Protein Sequence MGVLGRVLLWLQLCALTQAVSKLWVPNTDFDVAANWSQNRTPCAGGAVEFPADKMVSVLVQEGHAVSDMLLPLDGELVLASGAGFGVSDVGSHLDCGAGEPAVFRDSDRFSWHDPHLWRSGDEAPGLFFVDAERVPCRHDDVFFPPSASFRVGLGPGASPVRVRSISALGRTFTRDEDLAVFLASRAGRLRFHGPGALSVGPEDCADPSGCVCGNAEAQPWICAALLQPLGGRCPQAACHSALRPQGQCCDLCGAVVLLTHGPAFDLERYRARILDTFLGLPQYHGLQVAVSKVPRSSRLREADTEIQVVLVENGPETGGAGRLARALLADVAENGEALGVLEATMRESGAHVWGSSAAGLAGGVAAAVLLALLVLLVAPPLLRRAGRLRWRRHEAAAPAGAPLGFRNPVFDVTASEELPLPRRLSLVPKAAADSTSHSYFVNPLFAGAEAEA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0058-Ab Anti-AMNLS/ AMN/ PRO1028 monoclonal antibody
    Target Antigen GM-Tg-g-MP0058-Ag AMN VLP (virus-like particle)
    ORF Viral Vector pGMLP001763 Human AMN Lentivirus plasmid
    ORF Viral Vector vGMLP001763 Human AMN Lentivirus particle


    Target information

    Target ID GM-MP0058
    Target Name AMN
    Gene ID 81693, 93835, 106999578, 314459, 101084117, 403434, 767976, 106782539
    Gene Symbol and Synonyms AMN,amnionless,IGS2,PRO1028
    Uniprot Accession Q9BXJ7
    Uniprot Entry Name AMNLS_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000166126
    Target Classification Not Available

    The protein encoded by this gene is a type I transmembrane protein. It is thought to modulate bone morphogenetic protein (BMP) receptor function by serving as an accessory or coreceptor, and thus facilitates or hinders BMP binding. It is known that the mouse AMN gene is expressed in the extraembryonic visceral endoderm layer during gastrulation, but it is found to be mutated in amnionless mouse. The encoded protein has sequence similarity to short gastrulation (Sog) and procollagen IIA proteins in Drosophila. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.