Human RARG/NR1B3/RARC ORF/cDNA clone-Lentivirus plasmid (NM_000966)

SKU: pGMLP001553
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human RARG/NR1B3/RARC Lentiviral expression plasmid for RARG lentivirus packaging, RARG lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf MSDS
pdf Datasheet
pdf Terms of Use
pdf Map
Target products collection

Go to RARG/NR1B3 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $682.2
Shipping fee: Limited-time free


Product Description

Catalog ID pGMLP001553
Gene Name RARG
Accession Number NM_000966
Gene ID 5916
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1365 bp
Gene Alias NR1B3,RARC
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCCACCAATAAGGAGCGACTCTTTGCGGCTGGTGCCCTGGGGCCTGGATCTGGCTACCCAGGGGCAGGTTTCCCCTTCGCCTTCCCAGGGGCACTCAGGGGGTCTCCGCCTTTCGAGATGCTGAGCCCTAGCTTCCGGGGCCTGGGCCAGCCTGACCTCCCCAAGGAGATGGCCTCTCTGTCGGTGGAGACACAGAGCACCAGCTCAGAGGAGATGGTGCCCAGCTCGCCCTCGCCCCCTCCGCCTCCTCGGGTCTACAAGCCATGCTTCGTGTGCAATGACAAGTCCTCTGGCTACCACTATGGGGTCAGCTCTTGTGAAGGCTGCAAGGGCTTCTTTCGCCGAAGCATCCAGAAGAACATGGTGTACACGTGTCACCGCGACAAAAACTGTATCATCAACAAGGTGACCAGGAATCGCTGCCAGTACTGCCGGCTACAGAAGTGCTTCGAAGTGGGCATGTCCAAGGAAGCTGTGCGAAATGACCGGAACAAGAAGAAGAAAGAGGTGAAGGAAGAAGGGTCACCTGACAGCTATGAGCTGAGCCCTCAGTTAGAAGAGCTCATCACCAAGGTCAGCAAAGCCCATCAGGAGACTTTCCCCTCGCTCTGCCAGCTGGGCAAGTATACCACGAACTCCAGTGCAGACCACCGCGTGCAGCTGGATCTGGGGCTGTGGGACAAGTTCAGTGAGCTGGCTACCAAGTGCATCATCAAGATCGTGGAGTTTGCCAAGCGGTTGCCTGGCTTTACAGGGCTCAGCATTGCTGACCAGATCACTCTGCTCAAAGCTGCCTGCCTAGATATCCTGATGCTGCGTATCTGCACAAGGTACACCCCAGAGCAGGACACCATGACCTTCTCCGACGGGCTGACCCTGAACCGGACCCAGATGCACAATGCCGGCTTCGGGCCCCTCACAGACCTTGTCTTTGCCTTTGCTGGGCAGCTCCTGCCCCTGGAGATGGATGACACCGAGACAGGGCTGCTCAGCGCCATCTGCCTCATCTGCGGAGACCGCATGGACCTGGAGGAGCCCGAAAAAGTGGACAAGCTGCAGGAGCCACTGCTGGAAGCCCTGAGGCTGTACGCCCGGCGCCGGCGGCCCAGCCAGCCCTACATGTTCCCAAGGATGCTAATGAAAATCACCGACCTCCGGGGCATCAGCACTAAGGGAGCTGAAAGGGCCATTACTCTGAAGATGGAGATTCCAGGCCCGATGCCTCCCTTAATCCGAGAGATGCTGGAGAACCCTGAAATGTTTGAGGATGACTCCTCGCAGCCTGGTCCCCACCCCAATGCCTCTAGCGAGGATGAGGTTCCTGGGGGCCAGGGCAAAGGGGGCCTGAAGTCCCCAGCCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T82146-Ab Anti-RARG monoclonal antibody
    Target Antigen GM-Tg-g-T82146-Ag RARG protein
    ORF Viral Vector pGMLP001553 Human RARG Lentivirus plasmid
    ORF Viral Vector vGMLP001553 Human RARG Lentivirus particle


    Target information

    Target ID GM-T82146
    Target Name RARG
    Gene ID 5916, 19411, 699532, 685072, 101083275, 486508, 540425, 100062026
    Gene Symbol and Synonyms NR1B3,RAR-gamma,RARC,RARD,RARG,RARgamma,RARgamma2
    Uniprot Accession P13631
    Uniprot Entry Name RARG_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000172819
    Target Classification Not Available

    This gene encodes a retinoic acid receptor that belongs to the nuclear hormone receptor family. Retinoic acid receptors (RARs) act as ligand-dependent transcriptional regulators. When bound to ligands, RARs activate transcription by binding as heterodimers to the retinoic acid response elements (RARE) found in the promoter regions of the target genes. In their unbound form, RARs repress transcription of their target genes. RARs are involved in various biological processes, including limb bud development, skeletal growth, and matrix homeostasis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.