Human GABRA1/ECA4/EIEE19 ORF/cDNA clone-Lentivirus plasmid (NM_001127648)
SKU: pGMLP001509
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human GABRA1/ECA4/EIEE19 Lentiviral expression plasmid for GABRA1 lentivirus packaging, GABRA1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
GABRA1/ECA4 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP001509 |
Gene Name | GABRA1 |
Accession Number | NM_001127648 |
Gene ID | 2554 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1371 bp |
Gene Alias | ECA4,EIEE19,EJM,EJM5 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGGAAAAGTCCAGGTCTGTCTGACTGTCTTTGGGCCTGGATCCTCCTTCTGAGCACACTGACTGGAAGAAGCTATGGACAGCCGTCATTACAAGATGAACTTAAAGACAATACCACTGTCTTCACCAGGATTTTGGACAGACTCCTAGATGGTTATGACAATCGCCTGAGACCAGGATTGGGAGAGCGTGTAACCGAAGTGAAGACTGATATCTTCGTCACCAGTTTCGGACCCGTTTCAGACCATGATATGGAATATACAATAGATGTATTTTTCCGTCAAAGCTGGAAGGATGAAAGGTTAAAATTTAAAGGACCTATGACAGTCCTCCGGTTAAATAACCTAATGGCAAGTAAAATCTGGACTCCGGACACATTTTTCCACAATGGAAAGAAGTCAGTGGCCCACAACATGACCATGCCCAACAAACTCCTGCGGATCACAGAGGATGGCACCTTGCTGTACACCATGAGGCTGACAGTGAGAGCTGAATGTCCGATGCATTTGGAGGACTTCCCTATGGATGCCCATGCTTGCCCACTAAAATTTGGAAGTTATGCTTATACAAGAGCAGAAGTTGTTTATGAATGGACCAGAGAGCCAGCACGCTCAGTGGTTGTAGCAGAAGATGGATCACGTCTAAACCAGTATGACCTTCTTGGACAAACAGTAGACTCTGGAATTGTCCAGTCAAGTACAGGAGAATATGTTGTTATGACCACTCATTTCCACTTGAAGAGAAAGATTGGCTACTTTGTTATTCAAACATACCTGCCATGCATAATGACAGTGATTCTCTCACAAGTCTCCTTCTGGCTCAACAGAGAGTCTGTACCAGCAAGAACTGTCTTTGGAGTAACAACTGTGCTCACCATGACAACATTGAGCATCAGTGCCAGAAACTCCCTCCCTAAGGTGGCTTATGCAACAGCTATGGATTGGTTTATTGCCGTGTGCTATGCCTTTGTGTTCTCAGCTCTGATTGAGTTTGCCACAGTAAACTATTTCACTAAGAGAGGTTATGCATGGGATGGCAAAAGTGTGGTTCCAGAAAAGCCAAAGAAAGTAAAGGATCCTCTTATTAAGAAAAACAACACTTACGCTCCAACAGCAACCAGCTACACCCCTAATTTGGCCAGGGGCGACCCGGGCTTAGCCACCATTGCTAAAAGTGCAACCATAGAACCTAAAGAGGTCAAGCCCGAAACAAAACCACCAGAACCCAAGAAAACCTTTAACAGTGTCAGCAAAATTGACCGACTGTCAAGAATAGCCTTCCCGCTGCTATTTGGAATCTTTAACTTAGTCTACTGGGCTACGTATTTAAACAGAGAGCCTCAGCTAAAAGCCCCCACACCACATCAATAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T51487-Ab | Anti-GBRA1/ GABRA1/ ECA4 monoclonal antibody |
Target Antigen | GM-Tg-g-T51487-Ag | GABRA1 VLP (virus-like particle) |
ORF Viral Vector | pGMLP001509 | Human GABRA1 Lentivirus plasmid |
ORF Viral Vector | vGMLP001509 | Human GABRA1 Lentivirus particle |
Target information
Target ID | GM-T51487 |
Target Name | GABRA1 |
Gene ID | 2554, 14394, 574302, 29705, 100286792, 489143, 780973, 100070870 |
Gene Symbol and Synonyms | DEE19,ECA4,EIEE19,EJM,EJM5,GABAA-alpha1,GABAAR-alpha1,Gabra-1,GABRA1 |
Uniprot Accession | P14867 |
Uniprot Entry Name | GBRA1_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000022355 |
Target Classification | Ion Channel |
This gene encodes a gamma-aminobutyric acid (GABA) receptor. GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. GABA-A receptors are pentameric, consisting of proteins from several subunit classes: alpha, beta, gamma, delta and rho. Mutations in this gene cause juvenile myoclonic epilepsy and childhood absence epilepsy type 4. Multiple transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.