Human WNT16 ORF/cDNA clone-Lentivirus plasmid (NM_057168)

Cat. No.: pGMLP001440
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human WNT16/ Lentiviral expression plasmid for WNT16 lentivirus packaging, WNT16 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to WNT16/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $607.44
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001440
Gene Name WNT16
Accession Number NM_057168
Gene ID 51384
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1098 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGACAGGGCGGCGCTCCTGGGACTGGCCCGCTTGTGCGCGCTGTGGGCAGCCCTGCTCGTGCTGTTCCCCTACGGAGCCCAAGGAAACTGGATGTGGTTGGGCATTGCCTCCTTCGGGGTTCCAGAGAAGCTGGGCTGCGCCAATTTGCCGCTGAACAGCCGCCAGAAGGAGCTGTGCAAGAGGAAACCGTACCTGCTGCCGAGCATCCGAGAGGGCGCCCGGCTGGGCATTCAGGAGTGCGGGAGCCAGTTCAGACACGAGAGATGGAACTGCATGATCACCGCCGCCGCCACTACCGCCCCGATGGGCGCCAGCCCCCTCTTTGGCTACGAGCTGAGCAGCGGCACCAAAGAGACAGCATTTATTTATGCTGTGATGGCTGCAGGCCTGGTGCATTCTGTGACCAGGTCATGCAGTGCAGGCAACATGACAGAGTGTTCCTGTGACACCACCTTGCAGAACGGCGGCTCAGCAAGTGAAGGCTGGCACTGGGGGGGCTGCTCCGATGATGTCCAGTATGGCATGTGGTTCAGCAGAAAGTTCCTAGATTTCCCCATCGGAAACACCACGGGCAAAGAAAACAAAGTACTATTAGCAATGAACCTACATAACAATGAAGCTGGAAGGCAGGCTGTCGCCAAGTTGATGTCAGTAGACTGCCGCTGCCACGGAGTTTCCGGCTCCTGTGCTGTGAAAACATGCTGGAAAACCATGTCTTCTTTTGAAAAGATTGGCCATTTGTTGAAGGATAAATATGAAAACAGTATCCAGATATCAGACAAAACAAAGAGGAAAATGCGCAGGAGAGAAAAAGATCAGAGGAAAATACCAATCCATAAGGATGATCTGCTCTATGTTAATAAGTCTCCCAACTACTGTGTAGAAGATAAGAAACTGGGAATCCCAGGGACACAAGGCAGAGAATGCAACCGTACATCAGAGGGTGCAGATGGCTGCAACCTCCTCTGCTGTGGCCGAGGTTACAACACCCATGTGGTCAGGCACGTGGAGAGGTGTGAGTGTAAGTTCATCTGGTGCTGCTATGTCCGTTGCAGGAGGTGTGAAAGCATGACTGATGTCCACACTTGCAAGTAA
ORF Protein Sequence MDRAALLGLARLCALWAALLVLFPYGAQGNWMWLGIASFGVPEKLGCANLPLNSRQKELCKRKPYLLPSIREGARLGIQECGSQFRHERWNCMITAAATTAPMGASPLFGYELSSGTKETAFIYAVMAAGLVHSVTRSCSAGNMTECSCDTTLQNGGSASEGWHWGGCSDDVQYGMWFSRKFLDFPIGNTTGKENKVLLAMNLHNNEAGRQAVAKLMSVDCRCHGVSGSCAVKTCWKTMSSFEKIGHLLKDKYENSIQISDKTKRKMRRREKDQRKIPIHKDDLLYVNKSPNYCVEDKKLGIPGTQGRECNRTSEGADGCNLLCCGRGYNTHVVRHVERCECKFIWCCYVRCRRCESMTDVHTCK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0557-Ab Anti-WNT16 functional antibody
    Target Antigen GM-Tg-g-SE0557-Ag WNT16 protein
    Cytokine cks-Tg-g-GM-SE0557 wingless-type MMTV integration site family, member 16 (WNT16) protein & antibody
    ORF Viral Vector pGMLP001440 Human WNT16 Lentivirus plasmid
    ORF Viral Vector vGMLP001440 Human WNT16 Lentivirus particle


    Target information

    Target ID GM-SE0557
    Target Name WNT16
    Gene ID 51384, 93735, 694069, 500047, 101090252, 612328, 538627, 100071393
    Gene Symbol and Synonyms E130309I19Rik,WNT16
    Uniprot Accession Q9UBV4
    Uniprot Entry Name WNT16_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000002745
    Target Classification Not Available

    The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It contains two transcript variants diverging at the 5' termini. These two variants are proposed to be the products of separate promoters and not to be splice variants from a single promoter. They are differentially expressed in normal tissues, one of which (variant 2) is expressed at significant levels only in the pancreas, whereas another one (variant 1) is expressed more ubiquitously with highest levels in adult kidney, placenta, brain, heart, and spleen. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.