Human HTRA3/Prsp/ Tasp ORF/cDNA clone-Lentivirus plasmid (NM_053044)

Pre-made Human HTRA3/Prsp/ Tasp Lentiviral expression plasmid for HTRA3 lentivirus packaging, HTRA3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to HTRA3/Prsp products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP001396 Human HTRA3 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP001396
Gene Name HTRA3
Accession Number NM_053044
Gene ID 94031
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1362 bp
Gene Alias Prsp, Tasp
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCAGGCGCGAGCGCTGCTCCTGGCCGCGTTGGCCGCGCTGGCGCTGGCCCGGGAGCCCCCTGCGGCGCCGTGTCCCGCGCGCTGCGACGTGTCGCGGTGTCCCAGCCCCCGCTGCCCCGGCGGCTACGTGCCCGACCTCTGCAACTGCTGCCTGGTGTGCGCCGCCAGCGAGGGCGAGCCCTGTGGCGGCCCTCTGGACTCGCCTTGCGGCGAGAGCCTGGAGTGCGTGCGCGGCCTATGCCGCTGCCGCTGGTCGCACGCCGTGTGTGGCACCGACGGGCACACCTATGCCAACGTGTGCGCGCTGCAGGCGGCCAGCCGCCGCGCGCTGCAGCTCTCCGGGACGCCCGTGCGCCAGCTGCAGAAGGGCGCCTGCCCGTTGGGTCTCCACCAGCTGAGCAGCCCGCGCTACAAGTTCAACTTCATTGCTGACGTGGTGGAGAAGATCGCACCAGCCGTGGTCCACATAGAGCTCTTCCTGAGACACCCGCTGTTTGGCCGCAACGTGCCCCTGTCCAGCGGTTCTGGCTTCATCATGTCAGAGGCCGGCCTGATCATCACCAATGCCCACGTGGTGTCCAGCAACAGTGCTGCCCCGGGCAGGCAGCAGCTCAAGGTGCAGCTACAGAATGGGGACTCCTATGAGGCCACCATCAAAGACATCGACAAGAAGTCGGACATTGCCACCATCAAGATCCATCCCAAGAAAAAGCTCCCTGTGTTGTTGCTGGGTCACTCGGCCGACCTGCGGCCTGGGGAGTTTGTGGTGGCCATCGGCAGTCCCTTCGCCCTACAGAACACAGTGACAACGGGCATCGTCAGCACTGCCCAGCGGGAGGGCAGGGAGCTGGGCCTCCGGGACTCCGACATGGACTACATCCAGACGGATGCCATCATCAACTACGGGAACTCCGGGGGACCACTGGTGAACCTGGATGGCGAGGTCATTGGCATCAACACGCTCAAGGTCACGGCTGGCATCTCCTTTGCCATCCCCTCAGACCGCATCACACGGTTCCTCACAGAGTTCCAAGACAAGCAGATCAAAGACTGGAAGAAGCGCTTCATCGGCATACGGATGCGGACGATCACACCAAGCCTGGTGGATGAGCTGAAGGCCAGCAACCCGGACTTCCCAGAGGTCAGCAGTGGAATTTATGTGCAAGAGGTTGCGCCGAATTCACCTTCTCAGAGAGGCGGCATCCAAGATGGTGACATCATCGTCAAGGTCAACGGGCGTCCTCTAGTGGACTCGAGTGAGCTGCAGGAGGCCGTGCTGACCGAGTCTCCTCTCCTACTGGAGGTGCGGCGGGGGAACGACGACCTCCTCTTCAGCATCGCACCTGAGGTGGTCATGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0972-Ab Anti-HTRA3/ Prsp/ Tasp functional antibody
    Target Antigen GM-Tg-g-SE0972-Ag HTRA3 protein
    ORF Viral Vector pGMLV000350 Rat Htra3 Lentivirus plasmid
    ORF Viral Vector pGMLP001396 Human HTRA3 Lentivirus plasmid
    ORF Viral Vector vGMLV000350 Rat Htra3 Lentivirus particle
    ORF Viral Vector vGMLP001396 Human HTRA3 Lentivirus particle


    Target information

    Target ID GM-SE0972
    Target Name HTRA3
    Gene ID 94031, 78558, 722638, 360959, 101089007, 100687287, 100336523, 100070406
    Gene Symbol and Synonyms 2210021K23Rik,9530081K03Rik,HTRA3,Prsp,RGD1308120,Tasp
    Uniprot Accession P83110
    Uniprot Entry Name HTRA3_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000170801
    Target Classification Not Available

    Enables endopeptidase activity; identical protein binding activity; and serine-type peptidase activity. Involved in proteolysis. Predicted to be located in extracellular region. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.