Human SMAD2/hMAD-2/hSMAD2 ORF/cDNA clone-Lentivirus plasmid (NM_005901.5)

Cat. No.: pGMLP001353
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human SMAD2/hMAD-2/hSMAD2 Lentiviral expression plasmid for SMAD2 lentivirus packaging, SMAD2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to SMAD2/hMAD-2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $693.12
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001353
Gene Name SMAD2
Accession Number NM_005901.5
Gene ID 4087
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1404 bp
Gene Alias hMAD-2,hSMAD2,JV18,JV18-1,MADH2,MADR2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCGTCCATCTTGCCATTCACGCCGCCAGTTGTGAAGAGACTGCTGGGATGGAAGAAGTCAGCTGGTGGGTCTGGAGGAGCAGGCGGAGGAGAGCAGAATGGGCAGGAAGAAAAGTGGTGTGAGAAAGCAGTGAAAAGTCTGGTGAAGAAGCTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCAAAACTGTAATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAGATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGTATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCATCATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACCCTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCTAACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATTGAGCCACAGAGTAATTATATTCCAGAAACGCCACCTCCTGGATATATCAGTGAAGATGGAGAAACAAGTGACCAACAGTTGAATCAAAGTATGGACACAGGCTCTCCAGCAGAACTATCTCCTACTACTCTTTCCCCTGTTAATCATAGCTTGGATTTACAGCCAGTTACTTACTCAGAACCTGCATTTTGGTGTTCGATAGCATATTATGAATTAAATCAGAGGGTTGGAGAAACCTTCCATGCATCACAGCCCTCACTCACTGTAGATGGCTTTACAGACCCATCAAATTCAGAGAGGTTCTGCTTAGGTTTACTCTCCAATGTTAACCGAAATGCCACGGTAGAAATGACAAGAAGGCATATAGGAAGAGGAGTGCGCTTATACTACATAGGTGGGGAAGTTTTTGCTGAGTGCCTAAGTGATAGTGCAATCTTTGTGCAGAGCCCCAATTGTAATCAGAGATATGGCTGGCACCCTGCAACAGTGTGTAAAATTCCACCAGGCTGTAATCTGAAGATCTTCAACAACCAGGAATTTGCTGCTCTTCTGGCTCAGTCTGTTAATCAGGGTTTTGAAGCCGTCTATCAGCTAACTAGAATGTGCACCATAAGAATGAGTTTTGTGAAAGGGTGGGGAGCAGAATACCGAAGGCAGACGGTAACAAGTACTCCTTGCTGGATTGAACTTCATCTGAATGGACCTCTACAGTGGTTGGACAAAGTATTAACTCAGATGGGATCCCCTTCAGTGCGTTGCTCAAGCATGTCATAA
ORF Protein Sequence MSSILPFTPPVVKRLLGWKKSAGGSGGAGGGEQNGQEEKWCEKAVKSLVKKLKKTGRLDELEKAITTQNCNTKCVTIPSTCSEIWGLSTPNTIDQWDTTGLYSFSEQTRSLDGRLQVSHRKGLPHVIYCRLWRWPDLHSHHELKAIENCEYAFNLKKDEVCVNPYHYQRVETPVLPPVLVPRHTEILTELPPLDDYTHSIPENTNFPAGIEPQSNYIPETPPPGYISEDGETSDQQLNQSMDTGSPAELSPTTLSPVNHSLDLQPVTYSEPAFWCSIAYYELNQRVGETFHASQPSLTVDGFTDPSNSERFCLGLLSNVNRNATVEMTRRHIGRGVRLYYIGGEVFAECLSDSAIFVQSPNCNQRYGWHPATVCKIPPGCNLKIFNNQEFAALLAQSVNQGFEAVYQLTRMCTIRMSFVKGWGAEYRRQTVTSTPCWIELHLNGPLQWLDKVLTQMGSPSVRCSSMS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1753-Ab Anti-SMAD2 monoclonal antibody
    Target Antigen GM-Tg-g-IP1753-Ag SMAD2 protein
    Cytokine cks-Tg-g-GM-IP1753 SMAD family member 2 (SMAD2) protein & antibody
    ORF Viral Vector pGMLP001353 Human SMAD2 Lentivirus plasmid
    ORF Viral Vector pGMAD000190 Human SMAD2 Adenovirus plasmid
    ORF Viral Vector pGMLP-SPh-044 Human SMAD2 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-184 Human SMAD2 Adenovirus plasmid
    ORF Viral Vector pGMPC001202 Human SMAD2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC001609 Human SMAD2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP001353 Human SMAD2 Lentivirus particle
    ORF Viral Vector vGMAD000190 Human SMAD2 Adenovirus particle
    ORF Viral Vector vGMLP-SPh-044 Human SMAD2 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-184 Human SMAD2 Adenovirus particle


    Target information

    Target ID GM-IP1753
    Target Name SMAD2
    Gene ID 4087, 17126, 697581, 29357, 101087179, 480144, 516010, 100033843
    Gene Symbol and Synonyms 7120426M23Rik,CHTD8,hMAD-2,hSMAD2,JV18,JV18-1,LDS6,MADH2,MADR2,mMad2,Smad-2,SMAD2
    Uniprot Accession Q15796
    Uniprot Entry Name SMAD2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000175387
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein mediates the signal of the transforming growth factor (TGF)-beta, and thus regulates multiple cellular processes, such as cell proliferation, apoptosis, and differentiation. This protein is recruited to the TGF-beta receptors through its interaction with the SMAD anchor for receptor activation (SARA) protein. In response to TGF-beta signal, this protein is phosphorylated by the TGF-beta receptors. The phosphorylation induces the dissociation of this protein with SARA and the association with the family member SMAD4. The association with SMAD4 is important for the translocation of this protein into the nucleus, where it binds to target promoters and forms a transcription repressor complex with other cofactors. This protein can also be phosphorylated by activin type 1 receptor kinase, and mediates the signal from the activin. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2012]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.