Human GOSR1/GOLIM2/GOS-28 ORF/cDNA clone-Lentivirus plasmid (NM_004871)

Cat. No.: pGMLP001186
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human GOSR1/GOLIM2/GOS-28 Lentiviral expression plasmid for GOSR1 lentivirus packaging, GOSR1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to GOSR1/GOLIM2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $488.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001186
Gene Name GOSR1
Accession Number NM_004871
Gene ID 9527
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 753 bp
Gene Alias GOLIM2,GOS-28,GOS28,GOS28/P28,GS28,P28
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGGCAGGGACCAGCAGTTACTGGGAAGATCTCAGGAAACAGGCTCGACAGCTGGAAAATGAACTTGACCTGAAACTAGTTTCCTTCAGCAAACTATGTACAAGTTACAGTCATAGCAGTACCCGAGATGGAAGACGCGACAGGTATAGTTCTGATACAACACCCCTTTTAAATGGATCAAGCCAAGACAGAATGTTTGAGACAATGGCGATTGAGATTGAACAACTTTTGGCAAGGCTTACAGGGGTAAATGATAAAATGGCAGAATATACCAACAGTGCAGGTGTCCCCTCCTTGAATGCAGCCCTGATGCATACATTACAGCGGCATAGAGACATATTGCAGGATTATACACATGAATTCCATAAAACCAAAGCAAACTTTATGGCAATACGGGAAAGGGAGAATCTTATGGGATCAGTACGAAAAGATATTGAGTCATATAAAAGTGGGTCTGGAGTAAACAACAGAAGAACTGAGCTATTTTTGAAAGAACATGACCACCTTCGAAACTCAGATCGTCTGATAGAAGAGACAATAAGCATTGCTATGGCAACAAAAGAAAATATGACTTCACAGAGAGGAATGTTGAAGTCAATTCACAGCAAAATGAACACTTTGGCCAATCGTTTTCCTGCTGTAAACAGCCTGATCCAGAGGATCAACCTGAGGAAGCGGCGGGACTCGCTCATCCTAGGGGGTGTTATTGGGATCTGTACCATCCTGTTGCTGCTGTATGCGTTCCATTGA
ORF Protein Sequence MAAGTSSYWEDLRKQARQLENELDLKLVSFSKLCTSYSHSSTRDGRRDRYSSDTTPLLNGSSQDRMFETMAIEIEQLLARLTGVNDKMAEYTNSAGVPSLNAALMHTLQRHRDILQDYTHEFHKTKANFMAIRERENLMGSVRKDIESYKSGSGVNNRRTELFLKEHDHLRNSDRLIEETISIAMATKENMTSQRGMLKSIHSKMNTLANRFPAVNSLIQRINLRKRRDSLILGGVIGICTILLLLYAFH

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0922-Ab Anti-GOSR1 monoclonal antibody
    Target Antigen GM-Tg-g-IP0922-Ag GOSR1 protein
    ORF Viral Vector pGMLP001186 Human GOSR1 Lentivirus plasmid
    ORF Viral Vector vGMLP001186 Human GOSR1 Lentivirus particle


    Target information

    Target ID GM-IP0922
    Target Name GOSR1
    Gene ID 9527, 53334, 574268, 94189, 101090219, 491185, 511030, 100059771
    Gene Symbol and Synonyms GOLIM2,GOS-28,GOS28,GOS28/P28,GOSR1,GOSRI,GS28,P28
    Uniprot Accession O95249
    Uniprot Entry Name GOSR1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000108587
    Target Classification Not Available

    This gene encodes a trafficking membrane protein which transports proteins among the endoplasmic reticulum and the Golgi and between Golgi compartments. This protein is considered an essential component of the Golgi SNAP receptor (SNARE) complex. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.