Human AURKC/AIE2/ AIK3 ORF/cDNA clone-Lentivirus plasmid (NM_003160)
Pre-made Human AURKC/AIE2/ AIK3 Lentiviral expression plasmid for AURKC lentivirus packaging, AURKC lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to AURKC/AIE2 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP000985 | Human AURKC Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP000985 |
Gene Name | AURKC |
Accession Number | NM_003160 |
Gene ID | 6795 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 828 bp |
Gene Alias | AIE2, AIK3, ARK3, AurC, aurora-C, HEL-S-90, SPGF5, STK13 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCGGCGCCTCACAGTCGATGACTTTGAAATCGGGCGTCCCCTGGGCAAGGGGAAATTTGGGAATGTGTACCTGGCTCGGCTCAAGGAAAGCCATTTCATTGTGGCCCTGAAGGTTCTCTTCAAGTCGCAGATAGAGAAGGAAGGACTGGAGCACCAGCTGCGCCGGGAAATTGAGATCCAGGCTCATCTACAACACCCCAATATCCTGCGCCTGTATAACTATTTCCATGATGCACGCCGGGTGTACCTGATTCTGGAATATGCTCCAAGGGGTGAGCTCTACAAGGAGCTGCAGAAAAGCGAGAAATTAGATGAACAGCGCACAGCCACGATAATAGAGGAGTTGGCAGATGCCCTGACCTACTGCCATGACAAGAAAGTGATTCACAGAGATATTAAGCCAGAGAACCTGCTGCTGGGGTTCAGGGGTGAGGTGAAGATTGCAGATTTTGGCTGGTCTGTGCACACCCCCTCCCTGAGGAGGAAGACAATGTGTGGGACACTGGACTACTTGCCGCCAGAAATGATTGAGGGGAGAACATATGATGAAAAGGTGGATTTGTGGTGCATTGGAGTGCTCTGCTATGAGCTGCTGGTGGGATATCCACCCTTTGAGAGCGCCTCCCACAGTGAGACTTACAGACGCATCCTCAAGGTAGATGTGAGGTTTCCACTATCAATGCCTCTGGGGGCCCGGGACTTGATTTCCAGGCTTCTCAGATACCAGCCCTTGGAGAGACTGCCCCTGGCCCAGATCCTGAAGCACCCCTGGGTTCAGGCCCACTCCCGAAGGGTGCTGCCTCCCTGTGCTCAGATGGCTTCCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T97592-Ab | Anti-AURKC monoclonal antibody |
Target Antigen | GM-Tg-g-T97592-Ag | AURKC protein |
ORF Viral Vector | pGMLP000985 | Human AURKC Lentivirus plasmid |
ORF Viral Vector | vGMLP000985 | Human AURKC Lentivirus particle |
Target information
Target ID | GM-T97592 |
Target Name | AURKC |
Gene ID | 6795, 20871, 709801, 292554, 102899963, 119870878, 618599, 100051177 |
Gene Symbol and Synonyms | AIE1,AIE2,AIK3,ARK-3,ARK3,AurC,AURKC,aurora-C,HEL-S-90,IAK3,SPGF5,STK13 |
Uniprot Accession | Q9UQB9 |
Uniprot Entry Name | AURKC_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000105146 |
Target Classification | Kinase |
This gene encodes a member of the Aurora subfamily of serine/threonine protein kinases. The encoded protein is a chromosomal passenger protein that forms complexes with Aurora-B and inner centromere proteins and may play a role in organizing microtubules in relation to centrosome/spindle function during mitosis. This gene is overexpressed in several cancer cell lines, suggesting an involvement in oncogenic signal transduction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.