Human MGST1/GST12/MGST ORF/cDNA clone-Lentivirus plasmid (NM_020300)

Cat. No.: pGMLP000892
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MGST1/GST12/MGST Lentiviral expression plasmid for MGST1 lentivirus packaging, MGST1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to MGST1/GST12 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000892
Gene Name MGST1
Accession Number NM_020300
Gene ID 4257
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 468 bp
Gene Alias GST12,MGST,MGST-I
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGTTGACCTCACCCAGGTAATGGATGATGAAGTATTCATGGCTTTTGCATCCTATGCAACAATTATTCTTTCAAAAATGATGCTTATGAGTACTGCAACTGCATTCTATAGATTGACAAGAAAGGTTTTTGCCAATCCAGAAGACTGTGTAGCATTTGGCAAAGGAGAAAATGCCAAGAAGTATCTTCGAACAGATGACAGAGTAGAACGTGTACGCAGAGCCCACCTGAATGACCTTGAAAATATTATTCCATTTCTTGGAATTGGCCTCCTGTATTCCTTGAGTGGTCCCGACCCCTCTACAGCCATCCTGCACTTCAGACTATTTGTCGGAGCACGGATCTACCACACCATTGCATATTTGACACCCCTTCCCCAGCCAAATAGAGCTTTGAGTTTTTTTGTTGGATATGGAGTTACTCTTTCCATGGCTTACAGGTTGCTGAAAAGTAAATTGTACCTGTAA
ORF Protein Sequence MVDLTQVMDDEVFMAFASYATIILSKMMLMSTATAFYRLTRKVFANPEDCVAFGKGENAKKYLRTDDRVERVRRAHLNDLENIIPFLGIGLLYSLSGPDPSTAILHFRLFVGARIYHTIAYLTPLPQPNRALSFFVGYGVTLSMAYRLLKSKLYL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0811-Ab Anti-MGST1/ GST12/ MGST monoclonal antibody
    Target Antigen GM-Tg-g-MP0811-Ag MGST1 VLP (virus-like particle)
    ORF Viral Vector pGMLP000892 Human MGST1 Lentivirus plasmid
    ORF Viral Vector vGMLP000892 Human MGST1 Lentivirus particle


    Target information

    Target ID GM-MP0811
    Target Name MGST1
    Gene ID 4257, 56615, 701652, 171341, 101099565, 477683, 493719, 100064102
    Gene Symbol and Synonyms 1500002K10Rik,Gst,GST12,MGST,MGST-I,MGST1,PMAN
    Uniprot Accession P10620
    Uniprot Entry Name MGST1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Lung Cancer
    Gene Ensembl ENSG00000008394
    Target Classification Not Available

    The MAPEG (Membrane Associated Proteins in Eicosanoid and Glutathione metabolism) family consists of six human proteins, two of which are involved in the production of leukotrienes and prostaglandin E, important mediators of inflammation. Other family members, demonstrating glutathione S-transferase and peroxidase activities, are involved in cellular defense against toxic, carcinogenic, and pharmacologically active electrophilic compounds. This gene encodes a protein that catalyzes the conjugation of glutathione to electrophiles and the reduction of lipid hydroperoxides. This protein is localized to the endoplasmic reticulum and outer mitochondrial membrane where it is thought to protect these membranes from oxidative stress. Several transcript variants, some non-protein coding and some protein coding, have been found for this gene. [provided by RefSeq, May 2012]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.