Human CCL26/IMAC/MIP-4a ORF/cDNA clone-Lentivirus plasmid (NM_006072)
SKU: pGMLP000836
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human CCL26/IMAC/MIP-4a Lentiviral expression plasmid for CCL26 lentivirus packaging, CCL26 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
CCL26/IMAC products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP000836 |
Gene Name | CCL26 |
Accession Number | NM_006072 |
Gene ID | 10344 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 285 bp |
Gene Alias | IMAC,MIP-4a,MIP-4alpha,SCYA26,TSC-1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGATGGGCCTCTCCTTGGCCTCTGCTGTGCTCCTGGCCTCCCTCCTGAGTCTCCACCTTGGAACTGCCACACGTGGGAGTGACATATCCAAGACCTGCTGCTTCCAATACAGCCACAAGCCCCTTCCCTGGACCTGGGTGCGAAGCTATGAATTCACCAGTAACAGCTGCTCCCAGCGGGCTGTGATATTCACTACCAAAAGAGGCAAGAAAGTCTGTACCCATCCAAGGAAAAAATGGGTGCAAAAATACATTTCTTTACTGAAAACTCCGAAACAATTGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0746-Ab | Anti-CCL26/ IMAC/ MIP-4a functional antibody |
Target Antigen | GM-Tg-g-SE0746-Ag | CCL26 protein |
Cytokine | cks-Tg-g-GM-SE0746 | chemokine (C-C motif) ligand 26 (CCL26) protein & antibody |
ORF Viral Vector | pGMLP000836 | Human CCL26 Lentivirus plasmid |
ORF Viral Vector | vGMLP000836 | Human CCL26 Lentivirus particle |
Target information
Target ID | GM-SE0746 |
Target Name | CCL26 |
Gene ID | 10344, 541307, 716099, 685958, 101086525, 448789, 508387, 100630602 |
Gene Symbol and Synonyms | CCL26,Ccl26l,IMAC,MIP-4a,MIP-4alpha,SCYA26,TSC-1 |
Uniprot Accession | Q9Y258 |
Uniprot Entry Name | CCL26_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Cytokine Target |
Disease | Breast Cancer |
Gene Ensembl | ENSG00000006606 |
Target Classification | Not Available |
This gene is one of two Cys-Cys (CC) cytokine genes clustered on the q arm of chromosome 7. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for normal peripheral blood eosinophils and basophils. This protein also has antimicrobial activity, displaying an antibacterial effect on S. pneumoniae, S. aureus, Non-typeable H. influenzae, and P. aeruginosa. The product of this gene is one of three related chemokines that specifically activate chemokine receptor CCR3. This chemokine may contribute to the eosinophil accumulation in atopic diseases. [provided by RefSeq, Jul 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.