Human CCL26/IMAC/MIP-4a ORF/cDNA clone-Lentivirus plasmid (NM_006072)

SKU: pGMLP000836
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CCL26/IMAC/MIP-4a Lentiviral expression plasmid for CCL26 lentivirus packaging, CCL26 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to CCL26/IMAC products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free


Product Description

Catalog ID pGMLP000836
Gene Name CCL26
Accession Number NM_006072
Gene ID 10344
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 285 bp
Gene Alias IMAC,MIP-4a,MIP-4alpha,SCYA26,TSC-1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGATGGGCCTCTCCTTGGCCTCTGCTGTGCTCCTGGCCTCCCTCCTGAGTCTCCACCTTGGAACTGCCACACGTGGGAGTGACATATCCAAGACCTGCTGCTTCCAATACAGCCACAAGCCCCTTCCCTGGACCTGGGTGCGAAGCTATGAATTCACCAGTAACAGCTGCTCCCAGCGGGCTGTGATATTCACTACCAAAAGAGGCAAGAAAGTCTGTACCCATCCAAGGAAAAAATGGGTGCAAAAATACATTTCTTTACTGAAAACTCCGAAACAATTGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0746-Ab Anti-CCL26/ IMAC/ MIP-4a functional antibody
    Target Antigen GM-Tg-g-SE0746-Ag CCL26 protein
    Cytokine cks-Tg-g-GM-SE0746 chemokine (C-C motif) ligand 26 (CCL26) protein & antibody
    ORF Viral Vector pGMLP000836 Human CCL26 Lentivirus plasmid
    ORF Viral Vector vGMLP000836 Human CCL26 Lentivirus particle


    Target information

    Target ID GM-SE0746
    Target Name CCL26
    Gene ID 10344, 541307, 716099, 685958, 101086525, 448789, 508387, 100630602
    Gene Symbol and Synonyms CCL26,Ccl26l,IMAC,MIP-4a,MIP-4alpha,SCYA26,TSC-1
    Uniprot Accession Q9Y258
    Uniprot Entry Name CCL26_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Breast Cancer
    Gene Ensembl ENSG00000006606
    Target Classification Not Available

    This gene is one of two Cys-Cys (CC) cytokine genes clustered on the q arm of chromosome 7. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for normal peripheral blood eosinophils and basophils. This protein also has antimicrobial activity, displaying an antibacterial effect on S. pneumoniae, S. aureus, Non-typeable H. influenzae, and P. aeruginosa. The product of this gene is one of three related chemokines that specifically activate chemokine receptor CCR3. This chemokine may contribute to the eosinophil accumulation in atopic diseases. [provided by RefSeq, Jul 2020]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.