Human SAP30 ORF/cDNA clone-Lentivirus plasmid (NM_003864)

SKU: pGMLP000818
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human SAP30/ Lentiviral expression plasmid for SAP30 lentivirus packaging, SAP30 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf MSDS
pdf Datasheet
pdf Terms of Use
pdf Map
Target products collection

Go to SAP30/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $465.75
Shipping fee: Limited-time free


Product Description

Catalog ID pGMLP000818
Gene Name SAP30
Accession Number NM_003864
Gene ID 8819
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 663 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAACGGCTTCACGCCTGACGAGATGAGCCGCGGCGGGGATGCGGCCGCCGCAGTGGCCGCAGTGGTCGCTGCCGCGGCCGCCGCCGCCTCGGCGGGGAACGGGACCGGCGCGGGCACCGGGGCTGAGGTGCCGGGCGCGGGGGCGGTCTCAGCGGCTGGGCCCCCGGGGGCGGCCGGGCCGGGCCCCGGGCAACTGTGCTGCCTGCGGGAGGATGGTGAGCGGTGCGGCCGGGCGGCAGGCAACGCCAGCTTCAGCAAGAGGATCCAGAAGAGCATCTCCCAGAAGAAGGTGAAGATCGAGCTGGATAAGAGCGCAAGGCATCTTTACATATGTGATTATCATAAAAACTTAATTCAGAGTGTTCGAAACAGAAGAAAGAGAAAAGGGAGTGATGATGATGGAGGTGATTCACCTGTTCAAGATATTGATACCCCAGAGGTTGATTTATACCAATTACAAGTAAATACACTTAGGAGATACAAAAGACACTTCAAGCTACCAACCAGACCAGGACTTAATAAAGCACAACTTGTTGAGATAGTTGGTTGCCACTTTAGGTCTATTCCAGTGAATGAAAAAGACACCTTAACATATTTCATCTACTCAGTGAAGAATGACAAGAACAAATCAGATCTCAAGGTTGATAGTGGTGTTCACTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1565-Ab Anti-SAP30 functional antibody
    Target Antigen GM-Tg-g-SE1565-Ag SAP30 protein
    ORF Viral Vector pGMLP000818 Human SAP30 Lentivirus plasmid
    ORF Viral Vector vGMLP000818 Human SAP30 Lentivirus particle


    Target information

    Target ID GM-SE1565
    Target Name SAP30
    Gene ID 8819, 60406, 696519, 680122, 101088572, 607359, 781150, 100629571
    Gene Symbol and Synonyms 30kDa,SAP30
    Uniprot Accession O75446
    Uniprot Entry Name SAP30_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000164105
    Target Classification Not Available

    Histone acetylation plays a key role in the regulation of eukaryotic gene expression. Histone acetylation and deacetylation are catalyzed by multisubunit complexes. The protein encoded by this gene is a component of the histone deacetylase complex, which includes SIN3, SAP18, HDAC1, HDAC2, RbAp46, RbAp48, and other polypeptides. This complex is active in deacetylating core histone octamers, but inactive in deacetylating nucleosomal histones. A pseudogene of this gene is located on chromosome 3. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.