Human VEGFB/VEGFL/VRF ORF/cDNA clone-Lentivirus plasmid (NM_003377)

Cat. No.: pGMLP000756
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human VEGFB/VEGFL/VRF Lentiviral expression plasmid for VEGFB lentivirus packaging, VEGFB lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to VEGFB/VEGFL products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $456
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000756
Gene Name VEGFB
Accession Number NM_003377
Gene ID 7423
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 624 bp
Gene Alias VEGFL,VRF
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGCCCTCTGCTCCGCCGCCTGCTGCTCGCCGCACTCCTGCAGCTGGCCCCCGCCCAGGCCCCTGTCTCCCAGCCTGATGCCCCTGGCCACCAGAGGAAAGTGGTGTCATGGATAGATGTGTATACTCGCGCTACCTGCCAGCCCCGGGAGGTGGTGGTGCCCTTGACTGTGGAGCTCATGGGCACCGTGGCCAAACAGCTGGTGCCCAGCTGCGTGACTGTGCAGCGCTGTGGTGGCTGCTGCCCTGACGATGGCCTGGAGTGTGTGCCCACTGGGCAGCACCAAGTCCGGATGCAGATCCTCATGATCCGGTACCCGAGCAGTCAGCTGGGGGAGATGTCCCTGGAAGAACACAGCCAGTGTGAATGCAGACCTAAAAAAAAGGACAGTGCTGTGAAGCCAGACAGGGCTGCCACTCCCCACCACCGTCCCCAGCCCCGTTCTGTTCCGGGCTGGGACTCTGCCCCCGGAGCACCCTCCCCAGCTGACATCACCCATCCCACTCCAGCCCCAGGCCCCTCTGCCCACGCTGCACCCAGCACCACCAGCGCCCTGACCCCCGGACCTGCCGCTGCCGCTGCCGACGCCGCAGCTTCCTCCGTTGCCAAGGGCGGGGCTTAG
ORF Protein Sequence MSPLLRRLLLAALLQLAPAQAPVSQPDAPGHQRKVVSWIDVYTRATCQPREVVVPLTVELMGTVAKQLVPSCVTVQRCGGCCPDDGLECVPTGQHQVRMQILMIRYPSSQLGEMSLEEHSQCECRPKKKDSAVKPDRAATPHHRPQPRSVPGWDSAPGAPSPADITHPTPAPGPSAHAAPSTTSALTPGPAAAAADAAASSVAKGGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T30040-Ab Anti-VEGFB/ VEGFL/ VRF functional antibody
    Target Antigen GM-Tg-g-T30040-Ag VEGFB protein
    Cytokine cks-Tg-g-GM-T30040 Vascular endothelial growth factor B (VEGFB) protein & antibody
    ORF Viral Vector pGMLP000756 Human VEGFB Lentivirus plasmid
    ORF Viral Vector vGMLP000756 Human VEGFB Lentivirus particle


    Target information

    Target ID GM-T30040
    Target Name VEGFB
    Gene ID 7423, 22340, 722115, 89811, 101092465, 476036, 282121, 100055238
    Gene Symbol and Synonyms VEGF-B,VEGFB,VEGFL,VRF
    Uniprot Accession P49765
    Uniprot Entry Name VEGFB_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000173511
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a member of the PDGF (platelet-derived growth factor)/VEGF (vascular endothelial growth factor) family. The VEGF family members regulate the formation of blood vessels and are involved in endothelial cell physiology. This member is a ligand for VEGFR-1 (vascular endothelial growth factor receptor 1) and NRP-1 (neuropilin-1). Studies in mice showed that this gene was co-expressed with nuclear-encoded mitochondrial genes and the encoded protein specifically controlled endothelial uptake of fatty acids. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Sep 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.