Human IL1R2/CD121b/CDw121b ORF/cDNA clone-Lentivirus plasmid (NM_004633)

Cat. No.: pGMLP000705
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human IL1R2/CD121b/CDw121b Lentiviral expression plasmid for IL1R2 lentivirus packaging, IL1R2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to IL1R2/CD121b products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $635.16
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000705
Gene Name IL1R2
Accession Number NM_004633
Gene ID 7850
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1197 bp
Gene Alias CD121b,CDw121b,IL-1R-2,IL-1RT-2,IL-1RT2,IL1R2c,IL1RB
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTTGCGCTTGTACGTGTTGGTAATGGGAGTTTCTGCCTTCACCCTTCAGCCTGCGGCACACACAGGGGCTGCCAGAAGCTGCCGGTTTCGTGGGAGGCATTACAAGCGGGAGTTCAGGCTGGAAGGGGAGCCTGTAGCCCTGAGGTGCCCCCAGGTGCCCTACTGGTTGTGGGCCTCTGTCAGCCCCCGCATCAACCTGACATGGCATAAAAATGACTCTGCTAGGACGGTCCCAGGAGAAGAAGAGACACGGATGTGGGCCCAGGACGGTGCTCTGTGGCTTCTGCCAGCCTTGCAGGAGGACTCTGGCACCTACGTCTGCACTACTAGAAATGCTTCTTACTGTGACAAAATGTCCATTGAGCTCAGAGTTTTTGAGAATACAGATGCTTTCCTGCCGTTCATCTCATACCCGCAAATTTTAACCTTGTCAACCTCTGGGGTATTAGTATGCCCTGACCTGAGTGAATTCACCCGTGACAAAACTGACGTGAAGATTCAATGGTACAAGGATTCTCTTCTTTTGGATAAAGACAATGAGAAATTTCTAAGTGTGAGGGGGACCACTCACTTACTCGTACACGATGTGGCCCTGGAAGATGCTGGCTATTACCGCTGTGTCCTGACATTTGCCCATGAAGGCCAGCAATACAACATCACTAGGAGTATTGAGCTACGCATCAAGAAAAAAAAAGAAGAGACCATTCCTGTGATCATTTCCCCCCTCAAGACCATATCAGCTTCTCTGGGGTCAAGACTGACAATCCCGTGTAAGGTGTTTCTGGGAACCGGCACACCCTTAACCACCATGCTGTGGTGGACGGCCAATGACACCCACATAGAGAGCGCCTACCCGGGAGGCCGCGTGACCGAGGGGCCACGCCAGGAATATTCAGAAAATAATGAGAACTACATTGAAGTGCCATTGATTTTTGATCCTGTCACAAGAGAGGATTTGCACATGGATTTTAAATGTGTTGTCCATAATACCCTGAGTTTTCAGACACTACGCACCACAGTCAAGGAAGCCTCCTCCACGTTCTCCTGGGGCATTGTGCTGGCCCCACTTTCACTGGCCTTCTTGGTTTTGGGGGGAATATGGATGCACAGACGGTGCAAACACAGAACTGGAAAAGCAGATGGTCTGACTGTGCTATGGCCTCATCATCAAGACTTTCAATCCTATCCCAAGTGA
ORF Protein Sequence MLRLYVLVMGVSAFTLQPAAHTGAARSCRFRGRHYKREFRLEGEPVALRCPQVPYWLWASVSPRINLTWHKNDSARTVPGEEETRMWAQDGALWLLPALQEDSGTYVCTTRNASYCDKMSIELRVFENTDAFLPFISYPQILTLSTSGVLVCPDLSEFTRDKTDVKIQWYKDSLLLDKDNEKFLSVRGTTHLLVHDVALEDAGYYRCVLTFAHEGQQYNITRSIELRIKKKKEETIPVIISPLKTISASLGSRLTIPCKVFLGTGTPLTTMLWWTANDTHIESAYPGGRVTEGPRQEYSENNENYIEVPLIFDPVTREDLHMDFKCVVHNTLSFQTLRTTVKEASSTFSWGIVLAPLSLAFLVLGGIWMHRRCKHRTGKADGLTVLWPHHQDFQSYPK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T23347-Ab Anti-IL1R2/ CD121b/ CDw121b monoclonal antibody
    Target Antigen GM-Tg-g-T23347-Ag IL1R2 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T23347 interleukin 1 receptor, type II (IL1R2) protein & antibody
    ORF Viral Vector pGMLP000705 Human IL1R2 Lentivirus plasmid
    ORF Viral Vector vGMLP000705 Human IL1R2 Lentivirus particle


    Target information

    Target ID GM-T23347
    Target Name IL1R2
    Gene ID 7850, 16178, 711638, 117022, 101080961, 481330, 515700, 100033831
    Gene Symbol and Synonyms CD121b,CDw121b,IL-1R-2,IL-1R2,IL-1RII,IL-1RT-2,IL-1RT2,Il1r-2,IL1R2,IL1R2c,IL1RB
    Uniprot Accession P27930
    Uniprot Entry Name IL1R2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000115590
    Target Classification Not Available

    The protein encoded by this gene is a cytokine receptor that belongs to the interleukin 1 receptor family. This protein binds interleukin alpha (IL1A), interleukin beta (IL1B), and interleukin 1 receptor, type I(IL1R1/IL1RA), and acts as a decoy receptor that inhibits the activity of its ligands. Interleukin 4 (IL4) is reported to antagonize the activity of interleukin 1 by inducing the expression and release of this cytokine. This gene and three other genes form a cytokine receptor gene cluster on chromosome 2q12. Alternative splicing results in multiple transcript variants and protein isoforms. Alternative splicing produces both membrane-bound and soluble proteins. A soluble protein is also produced by proteolytic cleavage. [provided by RefSeq, May 2012]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.