Human CCL19/CKb11/ELC ORF/cDNA clone-Lentivirus plasmid (NM_006274)

Cat. No.: pGMLP000321
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CCL19/CKb11/ELC Lentiviral expression plasmid for CCL19 lentivirus packaging, CCL19 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf MSDS
pdf Datasheet
pdf Terms of Use
pdf Map
Target products collection

Go to CCL19/CKb11 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free


Product Description

Catalog ID pGMLP000321
Gene Name CCL19
Accession Number NM_006274
Gene ID 6363
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 297 bp
Gene Alias CKb11,ELC,MIP-3b,MIP3B,SCYA19
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCCCTGCTACTGGCCCTCAGCCTGCTGGTTCTCTGGACTTCCCCAGCCCCAACTCTGAGTGGCACCAATGATGCTGAAGACTGCTGCCTGTCTGTGACCCAGAAACCCATCCCTGGGTACATCGTGAGGAACTTCCACTACCTTCTCATCAAGGATGGCTGCAGGGTGCCTGCTGTAGTGTTCACCACACTGAGGGGCCGCCAGCTCTGTGCACCCCCAGACCAGCCCTGGGTAGAACGCATCATCCAGAGACTGCAGAGGACCTCAGCCAAGATGAAGCGCCGCAGCAGTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0744-Ab Anti-CCL19/ CKb11/ ELC functional antibody
    Target Antigen GM-Tg-g-SE0744-Ag CCL19 protein
    Cytokine cks-Tg-g-GM-SE0744 chemokine (C-C motif) ligand 19 (CCL19) protein & antibody
    ORF Viral Vector pGMLP000321 Human CCL19 Lentivirus plasmid
    ORF Viral Vector pGMLV001095 Human CCL19 Lentivirus plasmid
    ORF Viral Vector vGMLP000321 Human CCL19 Lentivirus particle
    ORF Viral Vector vGMLV001095 Human CCL19 Lentivirus particle


    Target information

    Target ID GM-SE0744
    Target Name CCL19
    Gene ID 6363, 24047, 574386, 362506, 101087015, 448793, 509167
    Gene Symbol and Synonyms CCL19,CKb11,ELC,exodus-3,Gm2023,MIP-3b,MIP3B,SCYA19
    Uniprot Accession Q99731
    Uniprot Entry Name CCL19_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000172724
    Target Classification Not Available

    This antimicrobial gene is one of several CC cytokine genes clustered on the p-arm of chromosome 9. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene may play a role in normal lymphocyte recirculation and homing. It also plays an important role in trafficking of T cells in thymus, and in T cell and B cell migration to secondary lymphoid organs. It specifically binds to chemokine receptor CCR7. [provided by RefSeq, Sep 2014]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.