Human BMP5 ORF/cDNA clone-Lentivirus plasmid (NM_021073)

SKU: pGMLP000115
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human BMP5/ Lentiviral expression plasmid for BMP5 lentivirus packaging, BMP5 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf MSDS
pdf Datasheet
pdf Terms of Use
pdf Map
Target products collection

Go to BMP5/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $682.2
Shipping fee: Limited-time free


Product Description

Catalog ID pGMLP000115
Gene Name BMP5
Accession Number NM_021073
Gene ID 653
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1365 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCATCTGACTGTATTTTTACTTAAGGGTATTGTGGGTTTCCTCTGGAGCTGCTGGGTTCTAGTGGGTTATGCAAAAGGAGGTTTGGGAGACAATCATGTTCACTCCAGTTTTATTTATAGAAGACTACGGAACCACGAAAGACGGGAAATACAAAGGGAAATTCTCTCTATCTTGGGTTTGCCTCACAGACCCAGACCATTTTCACCTGGAAAACAAGCGTCCTCTGCACCTCTCTTTATGCTGGATCTCTACAATGCCATGACCAATGAAGAAAATCCTGAAGAGTCGGAGTACTCAGTAAGGGCATCCTTGGCAGAAGAGACCAGAGGGGCAAGAAAGGGATACCCAGCCTCTCCCAATGGGTATCCTCGTCGCATACAGTTATCTCGGACGACTCCTCTGACCACCCAGAGTCCTCCTCTAGCCAGCCTCCATGATACCAACTTTCTGAATGATGCTGACATGGTCATGAGCTTTGTCAACTTAGTTGAAAGAGACAAGGATTTTTCTCACCAGCGAAGGCATTACAAAGAATTTCGATTTGATCTTACCCAAATTCCTCATGGAGAGGCAGTGACAGCAGCTGAATTCCGGATATACAAGGACCGGAGCAACAACCGATTTGAAAATGAAACAATTAAGATTAGCATATATCAAATCATCAAGGAATACACAAATAGGGATGCAGATCTGTTCTTGTTAGACACAAGAAAGGCCCAAGCTTTAGATGTGGGTTGGCTTGTCTTTGATATCACTGTGACCAGCAATCATTGGGTGATTAATCCCCAGAATAATTTGGGCTTACAGCTCTGTGCAGAAACAGGGGATGGACGCAGTATCAACGTAAAATCTGCTGGTCTTGTGGGAAGACAGGGACCTCAGTCAAAACAACCATTCATGGTGGCCTTCTTCAAGGCGAGTGAGGTACTTCTTCGATCCGTGAGAGCAGCCAACAAACGAAAAAATCAAAACCGCAATAAATCCAGCTCTCATCAGGACTCCTCCAGAATGTCCAGTGTTGGAGATTATAACACAAGTGAGCAAAAACAAGCCTGTAAGAAGCACGAACTCTATGTGAGCTTCCGGGATCTGGGATGGCAGGACTGGATTATAGCACCAGAAGGATACGCTGCATTTTATTGTGATGGAGAATGTTCTTTTCCACTTAACGCCCATATGAATGCCACCAACCACGCTATAGTTCAGACTCTGGTTCATCTGATGTTTCCTGACCACGTACCAAAGCCTTGTTGTGCTCCAACCAAATTAAATGCCATCTCTGTTCTGTACTTTGATGACAGCTCCAATGTCATTTTGAAAAAATATAGAAATATGGTAGTACGCTCATGTGGCTGCCACTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0686-Ab Anti-BMP5 functional antibody
    Target Antigen GM-Tg-g-SE0686-Ag BMP5 protein
    Cytokine cks-Tg-g-GM-SE0686 bone morphogenetic protein 5 (BMP5) protein & antibody
    ORF Viral Vector pGMLP000115 Human BMP5 Lentivirus plasmid
    ORF Viral Vector vGMLP000115 Human BMP5 Lentivirus particle


    Target information

    Target ID GM-SE0686
    Target Name BMP5
    Gene ID 653, 12160, 711989, 315824, 101097318, 474944, 507682, 100056806
    Gene Symbol and Synonyms BMP5,se
    Uniprot Accession P22003
    Uniprot Entry Name BMP5_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000112175
    Target Classification Not Available

    This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer, which plays a role in bone and cartilage development. Polymorphisms in this gene may be associated with osteoarthritis in human patients. This gene is differentially regulated in multiple human cancers. This gene encodes distinct protein isoforms that may be similarly proteolytically processed. [provided by RefSeq, Jul 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.