Human MRAP/B27/C21orf61 ORF/cDNA clone-Lentivirus plasmid (BC062721)

Cat. No.: pGMLP000034
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MRAP/B27/C21orf61 Lentiviral expression plasmid for MRAP lentivirus packaging, MRAP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to MRAP/B27 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $429.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP000034
Gene Name MRAP
Accession Number BC062721
Gene ID 56246
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 519 bp
Gene Alias B27,C21orf61,FALP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCAACGGGACCAACGCCTCTGCCCCATACTACAGCTATGAATACTACCTGGACTATCTGGACCTCATTCCCGTGGACGAGAAGAAGCTGAAAGCCCACAAACATTCCATCGTGATCGCATTCTGGGTTAGCCTGGCTGCCTTCGTGGTGCTGCTCTTCCTCATCTTGCTCTACATGTCCTGGTCCGCCTCCCCGCAGATGAGGAACAGCCCCAAGCACCACCAAACATGCCCCTGGAGTCACGGCCTCAACCTCCACCTCTGCATCCAGAAGTGCCTGCCGTGCCACAGGGAACCCCTGGCAACCTCACAGGCTCAGGCGAGCTCAGTGGAGCCAGGGAGCAGAACTGGCCCTGACCAGCCGCTACGACAGGAGAGCTCCTCCACGTTGCCCCTCGGGGGTTTCCAGACCCACCCCACTCTCCTCTGGGAACTGACCCTCAATGGGGGTCCCCTCGTCAGGAGCAAGCCCAGCGAGCCTCCCCCTGGAGACAGGACCTCTCAATTGCAGAGCTGA
ORF Protein Sequence MANGTNASAPYYSYEYYLDYLDLIPVDEKKLKAHKHSIVIAFWVSLAAFVVLLFLILLYMSWSASPQMRNSPKHHQTCPWSHGLNLHLCIQKCLPCHREPLATSQAQASSVEPGSRTGPDQPLRQESSSTLPLGGFQTHPTLLWELTLNGGPLVRSKPSEPPPGDRTSQLQS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0828-Ab Anti-MRAP/ B27/ C21orf61 monoclonal antibody
    Target Antigen GM-Tg-g-MP0828-Ag MRAP VLP (virus-like particle)
    ORF Viral Vector pGMLP000034 Human MRAP Lentivirus plasmid
    ORF Viral Vector pGMAP000279 Human MRAP Adenovirus plasmid
    ORF Viral Vector vGMLP000034 Human MRAP Lentivirus particle
    ORF Viral Vector vGMAP000279 Human MRAP Adenovirus particle


    Target information

    Target ID GM-MP0828
    Target Name MRAP
    Gene ID 56246, 77037, 701330, 288271, 101093795, 609708, 505743, 100063927
    Gene Symbol and Synonyms 1110025G12Rik,B27,C21orf61,FALP,FGD2,GCCD2,MRAP,MRAP1,ORF61,RGD1310648
    Uniprot Accession Q8TCY5
    Uniprot Entry Name MRAP_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000170262
    Target Classification Not Available

    This gene encodes a melanocortin receptor-interacting protein. The encoded protein regulates trafficking and function of the melanocortin 2 receptor in the adrenal gland. The encoded protein can also modulate signaling of other melanocortin receptors. Mutations in this gene have been associated with familial glucocorticoid deficiency type 2. Alternatively spliced transcript variants have been described. [provided by RefSeq, Dec 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.