Human IL18BP/IL18BPa ORF/cDNA clone-Lentivirus plasmid (NM_173042)

SKU: pGMLP000015
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human IL18BP/IL18BPa Lentiviral expression plasmid for IL18BP lentivirus packaging, IL18BP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to IL18BP/IL18BPa products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $446.25
Shipping fee: Limited-time free


Product Description

Catalog ID pGMLP000015
Gene Name IL18BP
Accession Number NM_173042
Gene ID 10068
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 585 bp
Gene Alias IL18BPa
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACCATGAGACACAACTGGACACCAGACCTCAGCCCTTTGTGGGTCCTGCTCCTGTGTGCCCACGTCGTCACTCTCCTGGTCAGAGCCACACCTGTCTCGCAGACCACCACAGCTGCCACTGCCTCAGTTAGAAGCACAAAGGACCCCTGCCCCTCCCAGCCCCCAGTGTTCCCAGCAGCTAAGCAGTGTCCAGCATTGGAAGTGACCTGGCCAGAGGTGGAAGTGCCACTGAATGGAACGCTGAGCTTATCCTGTGTGGCCTGCAGCCGCTTCCCCAACTTCAGCATCCTCTACTGGCTGGGCAATGGTTCCTTCATTGAGCACCTCCCAGGCCGACTGTGGGAGGGGAGCACCAGCCGGGAACGTGGGAGCACAGGTACGCAGCTGTGCAAGGCCTTGGTGCTGGAGCAGCTGACCCCTGCCCTGCACAGCACCAACTTCTCCTGTGTGCTCGTGGACCCTGAACAGGTTGTCCAGCGTCACGTCGTCCTGGCCCAGCTCTGGGCTGGGCTGAGGGCAACCTTGCCCCCCACCCAAGAAGCCCTGCCCTCCAGCCACAGCAGTCCACAGCAGCAGGGTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1023-Ab Anti-I18BP/ IL18BP/ IL18BPa functional antibody
    Target Antigen GM-Tg-g-SE1023-Ag IL18BP protein
    Cytokine cks-Tg-g-GM-SE1023 interleukin 18 binding protein (IL18BP) protein & antibody
    ORF Viral Vector pGMLP000015 Human IL18BP Lentivirus plasmid
    ORF Viral Vector pGMLV001571 Human IL18BP Lentivirus plasmid
    ORF Viral Vector vGMLP000015 Human IL18BP Lentivirus particle
    ORF Viral Vector vGMLV001571 Human IL18BP Lentivirus particle


    Target information

    Target ID GM-SE1023
    Target Name IL18BP
    Gene ID 10068, 16068, 100144607, 84388, 101096599, 476818, 617470, 100066161
    Gene Symbol and Synonyms FVH,Igifbp,IL-18BP,IL18BP,IL18BPa,MC54L
    Uniprot Accession O95998
    Uniprot Entry Name I18BP_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Malignant neoplasm of prostate
    Gene Ensembl ENSG00000137496
    Target Classification Not Available

    The protein encoded by this gene functions as an inhibitor of the proinflammatory cytokine, IL18. It binds IL18, prevents the binding of IL18 to its receptor, and thus inhibits IL18-induced IFN-gamma production, resulting in reduced T-helper type 1 immune responses. This protein is constitutively expressed and secreted in mononuclear cells. Elevated level of this protein is detected in the intestinal tissues of patients with Crohn's disease. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.