Human SHH/HHG1/HLP3 ORF/cDNA clone-Lentivirus plasmid (NM_000193.3)
Cat. No.: pGMLP-SPh-072
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human SHH/HHG1/HLP3 Lentiviral expression plasmid for SHH lentivirus packaging, SHH lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
SHH/HHG1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP-SPh-072 |
Gene Name | SHH |
Accession Number | NM_000193.3 |
Gene ID | 6469 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1389 bp |
Gene Alias | HHG1,HLP3,HPE3,MCOPCB5,ShhNC,SMMCI,TPT,TPTPS |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGCTGCTGCTGGCGAGATGTCTGCTGCTAGTCCTCGTCTCCTCGCTGCTGGTATGCTCGGGACTGGCGTGCGGACCGGGCAGGGGGTTCGGGAAGAGGAGGCACCCCAAAAAGCTGACCCCTTTAGCCTACAAGCAGTTTATCCCCAATGTGGCCGAGAAGACCCTAGGCGCCAGCGGAAGGTATGAAGGGAAGATCTCCAGAAACTCCGAGCGATTTAAGGAACTCACCCCCAATTACAACCCCGACATCATATTTAAGGATGAAGAAAACACCGGAGCGGACAGGCTGATGACTCAGAGGTGTAAGGACAAGTTGAACGCTTTGGCCATCTCGGTGATGAACCAGTGGCCAGGAGTGAAACTGCGGGTGACCGAGGGCTGGGACGAAGATGGCCACCACTCAGAGGAGTCTCTGCACTACGAGGGCCGCGCAGTGGACATCACCACGTCTGACCGCGACCGCAGCAAGTACGGCATGCTGGCCCGCCTGGCGGTGGAGGCCGGCTTCGACTGGGTGTACTACGAGTCCAAGGCACATATCCACTGCTCGGTGAAAGCAGAGAACTCGGTGGCGGCCAAATCGGGAGGCTGCTTCCCGGGCTCGGCCACGGTGCACCTGGAGCAGGGCGGCACCAAGCTGGTGAAGGACCTGAGCCCCGGGGACCGCGTGCTGGCGGCGGACGACCAGGGCCGGCTGCTCTACAGCGACTTCCTCACTTTCCTGGACCGCGACGACGGCGCCAAGAAGGTCTTCTACGTGATCGAGACGCGGGAGCCGCGCGAGCGCCTGCTGCTCACCGCCGCGCACCTGCTCTTTGTGGCGCCGCACAACGACTCGGCCACCGGGGAGCCCGAGGCGTCCTCGGGCTCGGGGCCGCCTTCCGGGGGCGCACTGGGGCCTCGGGCGCTGTTCGCCAGCCGCGTGCGCCCGGGCCAGCGCGTGTACGTGGTGGCCGAGCGTGACGGGGACCGCCGGCTCCTGCCCGCCGCTGTGCACAGCGTGACCCTAAGCGAGGAGGCCGCGGGCGCCTACGCGCCGCTCACGGCCCAGGGCACCATTCTCATCAACCGGGTGCTGGCCTCGTGCTACGCGGTCATCGAGGAGCACAGCTGGGCGCACCGGGCCTTCGCGCCCTTCCGCCTGGCGCACGCGCTCCTGGCTGCACTGGCGCCCGCGCGCACGGACCGCGGCGGGGACAGCGGCGGCGGGGACCGCGGGGGCGGCGGCGGCAGAGTAGCCCTAACCGCTCCAGGTGCTGCCGACGCTCCGGGTGCGGGGGCCACCGCGGGCATCCACTGGTACTCGCAGCTGCTCTACCAAATAGGCACCTGGCTCCTGGACAGCGAGGCCCTGCACCCGCTGGGCATGGCGGTCAAGTCCAGCTGA |
ORF Protein Sequence | MLLLARCLLLVLVSSLLVCSGLACGPGRGFGKRRHPKKLTPLAYKQFIPNVAEKTLGASGRYEGKISRNSERFKELTPNYNPDIIFKDEENTGADRLMTQRCKDKLNALAISVMNQWPGVKLRVTEGWDEDGHHSEESLHYEGRAVDITTSDRDRSKYGMLARLAVEAGFDWVYYESKAHIHCSVKAENSVAAKSGGCFPGSATVHLEQGGTKLVKDLSPGDRVLAADDQGRLLYSDFLTFLDRDDGAKKVFYVIETREPRERLLLTAAHLLFVAPHNDSATGEPEASSGSGPPSGGALGPRALFASRVRPGQRVYVVAERDGDRRLLPAAVHSVTLSEEAAGAYAPLTAQGTILINRVLASCYAVIEEHSWAHRAFAPFRLAHALLAALAPARTDRGGDSGGGDRGGGGGRVALTAPGAADAPGAGATAGIHWYSQLLYQIGTWLLDSEALHPLGMAVKSS |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T12075-Ab | Anti-SHH/ HHG1/ HLP3 monoclonal antibody |
Target Antigen | GM-Tg-g-T12075-Ag | SHH VLP (virus-like particle) |
ORF Viral Vector | pGMAAV000001 | Human SHH Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMLP-SPh-072 | Human SHH Lentivirus plasmid |
ORF Viral Vector | pGMAP-SPh-212 | Human SHH Adenovirus plasmid |
ORF Viral Vector | vGMAAV000001 | Human SHH Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMLP-SPh-072 | Human SHH Lentivirus particle |
ORF Viral Vector | vGMAP-SPh-212 | Human SHH Adenovirus particle |
Target information
Target ID | GM-T12075 |
Target Name | SHH |
Gene ID | 6469, 20423, 716553, 29499, 111557492, 608860, 286821, 100147450 |
Gene Symbol and Synonyms | 9530036O11Rik,Dsh,HHG1,HLP3,HPE3,Hx,Hxl3,M100081,MCOPCB5,SHH,ShhNC,SMMCI,TPT,TPTPS |
Uniprot Accession | Q15465 |
Uniprot Entry Name | SHH_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000164690 |
Target Classification | Not Available |
This gene encodes a protein that is instrumental in patterning the early embryo. It has been implicated as the key inductive signal in patterning of the ventral neural tube, the anterior-posterior limb axis, and the ventral somites. Of three human proteins showing sequence and functional similarity to the sonic hedgehog protein of Drosophila, this protein is the most similar. The protein is made as a precursor that is autocatalytically cleaved; the N-terminal portion is soluble and contains the signalling activity while the C-terminal portion is involved in precursor processing. More importantly, the C-terminal product covalently attaches a cholesterol moiety to the N-terminal product, restricting the N-terminal product to the cell surface and preventing it from freely diffusing throughout the developing embryo. Defects in this protein or in its signalling pathway are a cause of holoprosencephaly (HPE), a disorder in which the developing forebrain fails to correctly separate into right and left hemispheres. HPE is manifested by facial deformities. It is also thought that mutations in this gene or in its signalling pathway may be responsible for VACTERL syndrome, which is characterized by vertebral defects, anal atresia, tracheoesophageal fistula with esophageal atresia, radial and renal dysplasia, cardiac anomalies, and limb abnormalities. Additionally, mutations in a long range enhancer located approximately 1 megabase upstream of this gene disrupt limb patterning and can result in preaxial polydactyly. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.