Human IL10/CSIF/IL-10 ORF/cDNA clone-Adenovirus plasmid (BC104252)

SKU: pGMAP000484
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human IL10/CSIF/IL-10 adenoviral expression plasmid for IL10 adenovirus packaging, IL10 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.


Target products collection

Go to IL10/CSIF products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free


Product Description

Catalog ID pGMAP000484
Gene Name IL10
Accession Number BC104252
Gene ID 3586
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 537 bp
Gene Alias CSIF,IL-10,IL10A,TGIF
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
Sequence ATGCACAGCTCAGCACTGCTCTGTTGCCTGGTCCTCCTGACTGGGGTGAGGGCCAGCCCAGGCCAGGGCACCCAGTCTGAGAACAGCTGCACCCACTTCCCAGGCAACCTGCCTAACATGCTTCGAGATCTCCGAGATGCCTTCAGCAGAGTGAAGACTTTCTTTCAAATGAAGGATCAGCTGGACAACTTGTTGTTAAAGGAGTCCTTGCTGGAGGACTTTAAGGGTTACCTGGGTTGCCAAGCCTTGTCTGAGATGATCCAGTTTTACCTGGAGGAGGTGATGCCCCAAGCTGAGAACCAAGACCCAGACATCAAGGCGCATGTGAACTCCCTGGGGGAGAACCTGAAGACCCTCAGGCTGAGGCTACGGCGCTGTCATCGATTTCTTCCCTGTGAAAACAAGAGCAAGGCCGTGGAGCAGGTGAAGAATGCCTTTAATAAGCTCCAAGAGAAAGGCATCTACAAAGCCATGAGTGAGTTTGACATCTTCATCAACTACATAGAAGCCTACATGACAATGAAGATACGAAACTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T09092-Ab Anti-IL10/ CSIF/ GVHDS functional antibody
    Target Antigen GM-Tg-g-T09092-Ag IL10 protein
    Cytokine cks-Tg-g-GM-T09092 interleukin 10 (IL10) protein & antibody
    ORF Viral Vector pGMLV001166 Human IL-10 Lentivirus plasmid
    ORF Viral Vector pGMAD000014 Human IL10 Adenovirus plasmid
    ORF Viral Vector pGMAP000484 Human IL10 Adenovirus plasmid
    ORF Viral Vector pGMLP-IL-013 Human IL10 Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-096 Human IL10 Adenovirus plasmid
    ORF Viral Vector pGMPC004770 Human IL10 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV001166 Human IL-10 Lentivirus particle
    ORF Viral Vector vGMAD000014 Human IL10 Adenovirus particle
    ORF Viral Vector vGMAP000484 Human IL10 Adenovirus particle
    ORF Viral Vector vGMLP-IL-013 Human IL10 Lentivirus particle
    ORF Viral Vector vGMAP-IL-096 Human IL10 Adenovirus particle


    Target information

    Target ID GM-T09092
    Target Name IL10
    Gene ID 3586, 16153, 694931, 25325, 493683, 403628, 281246, 100034187
    Gene Symbol and Synonyms CSIF,GVHDS,If2a,IL-10,IL10,IL10A,IL10X,TGIF
    Uniprot Accession P22301
    Uniprot Entry Name IL10_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Immuno-oncology Target, Cytokine Target
    Disease Ovary Cancer, metastases, asthma, Malignant neoplasm of bladder
    Gene Ensembl ENSG00000136634
    Target Classification Checkpoint-Immuno Oncology

    The protein encoded by this gene is a cytokine produced primarily by monocytes and to a lesser extent by lymphocytes. This cytokine has pleiotropic effects in immunoregulation and inflammation. It down-regulates the expression of Th1 cytokines, MHC class II Ags, and costimulatory molecules on macrophages. It also enhances B cell survival, proliferation, and antibody production. This cytokine can block NF-kappa B activity, and is involved in the regulation of the JAK-STAT signaling pathway. Knockout studies in mice suggested the function of this cytokine as an essential immunoregulator in the intestinal tract. Mutations in this gene are associated with an increased susceptibility to HIV-1 infection and rheumatoid arthritis. [provided by RefSeq, May 2020]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.