Human IFNA1/IFL/IFN ORF/cDNA clone-Adenovirus plasmid (BC112300)

SKU: pGMAP000481
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human IFNA1/IFL/IFN adenoviral expression plasmid for IFNA1 adenovirus packaging, IFNA1 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.


Target products collection

Go to IFNA13/IFNA1/IFL products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free


Product Description

Catalog ID pGMAP000481
Gene Name IFNA1
Accession Number BC112300
Gene ID 3439
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 570 bp
Gene Alias IFL,IFN,IFN-ALPHA,IFNA13,IFNA@
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
Sequence ATGGCCTCGCCCTTTGCTTTACTGATGGTCCTGGTGGTGCTCAGCTGCAAGTCAAGCTGCTCTCTGGGCTGTGATCTCCCTGAGACCCACAGCCTGGATAACAGGAGGACCTTGATGCTCCTGGCACAAATGAGCAGAATCTCTCCTTCCTCCTGTCTGATGGACAGACATGACTTTGGATTTCCCCAGGAGGAGTTTGATGGCAACCAGTTCCAGAAGGCTCCAGCCATCTCTGTCCTCCATGAGCTGATCCAGCAGATCTTCAACCTCTTTACCACAAAAGATTCATCTGCTGCTTGGGATGAGGACCTCCTAGACAAATTCTGCACCGAACTCTACCAGCAGCTGAATGACTTGGAAGCCTGTGTGATGCAGGAGGAGAGGGTGGGAGAAACTCCCCTGATGAATGCGGACTCCATCTTGGCTGTGAAGAAATACTTCCGAAGAATCACTCTCTATCTGACAGAGAAGAAATACAGCCCTTGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGATCCCTCTCTTTATCAACAAACTTGCAAGAAAGATTAAGGAGGAAGGAATAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0977-Ab Anti-IFNA1/ IFNA13 functional antibody
    Target Antigen GM-Tg-g-SE0977-Ag IFNA13 protein
    Cytokine cks-Tg-g-GM-SE0977 interferon, alpha 13 (IFNA13) protein & antibody
    ORF Viral Vector pGMLP000155 Human IFNA13 Lentivirus plasmid
    ORF Viral Vector pGMLP000551 Human IFNA1 Lentivirus plasmid
    ORF Viral Vector pGMAD000576 Human IFNA1 Adenovirus plasmid
    ORF Viral Vector pGMAP000481 Human IFNA1 Adenovirus plasmid
    ORF Viral Vector vGMLP000155 Human IFNA13 Lentivirus particle
    ORF Viral Vector vGMLP000551 Human IFNA1 Lentivirus particle
    ORF Viral Vector vGMAD000576 Human IFNA1 Adenovirus particle
    ORF Viral Vector vGMAP000481 Human IFNA1 Adenovirus particle


    Target information

    Target ID GM-SE0977
    Target Name IFNA13
    Gene ID 3447
    Gene Symbol and Synonyms IFNA13
    Uniprot Accession P01562
    Uniprot Entry Name IFNA1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000233816
    Target Classification Not Available

    Predicted to enable cytokine activity and type I interferon receptor binding activity. Predicted to be involved in several processes, including B cell activation; lymphocyte activation involved in immune response; and positive regulation of peptidyl-serine phosphorylation of STAT protein. Predicted to be located in extracellular region. Predicted to be active in extracellular space.



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.