Human TP53/LFS1/p53 ORF/cDNA clone-Adenovirus plasmid (BC003596)

SKU: pGMAP000334
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TP53/LFS1/p53 adenoviral expression plasmid for TP53 adenovirus packaging, TP53 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

pdf MSDS
pdf Datasheet
pdf Terms of Use
Target products collection

Go to TP53 Y220C/TP53/LFS1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free


Product Description

Catalog ID pGMAP000334
Gene Name TP53
Accession Number BC003596
Gene ID 7157
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 1182 bp
Gene Alias LFS1,p53,TRP53
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
Sequence ATGGAGGAGCCGCAGTCAGATCCTAGCGTCGAGCCCCCTCTGAGTCAGGAAACATTTTCAGACCTATGGAAACTACTTCCTGAAAACAACGTTCTGTCCCCCTTGCCGTCCCAAGCAATGGATGATTTGATGCTGTCCCCGGACGATATTGAACAATGGTTCACTGAAGACCCAGGTCCAGATGAAGCTCCCAGAATGCCAGAGGCTGCTCCCCGCGTGGCCCCTGCACCAGCAGCTCCTACACCGGCGGCCCCTGCACCAGCCCCCTCCTGGCCCCTGTCATCTTCTGTCCCTTCCCAGAAAACCTACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCTTGCATTCTGGGACAGCCAAGTCTGTGACTTGCACGTACTCCCCTGCCCTCAACAAGATGTTTTGCCAACTGGCCAAGACCTGCCCTGTGCAGCTGTGGGTTGATTCCACACCCCCGCCCGGCACCCGCGTCCGCGCCATGGCCATCTACAAGCAGTCACAGCACATGACGGAGGTTGTGAGGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGGTCTGGCCCCTCCTCAGCATCTTATCCGAGTGGAAGGAAATTTGCGTGTGGAGTATTTGGATGACAGAAACACTTTTCGACATAGTGTGGTGGTGCCCTATGAGCCGCCTGAGGTTGGCTCTGACTGTACCACCATCCACTACAACTACATGTGTAACAGTTCCTGCATGGGCGGCATGAACCGGAGGCCCATCCTCACCATCATCACACTGGAAGACTCCAGTGGTAATCTACTGGGACGGAACAGCTTTGAGGTGCGTGTTTGTGCCTGTGCTGGGAGAGACCGGCGCACAGAGGAAGAGAATCTCCGCAAGAAAGGGGAGCCTCACCACGAGCTGCCCCCAGGGAGCACTAAGCGAGCACTGCCCAACAACACCAGCTCCTCTCCCCAGCCAAAGAAGAAACCACTGGATGGAGAATATTTCACCCTTCAGATCCGTGGGCGTGAGCGCTTCGAGATGTTCCGAGAGCTGAATGAGGCCTTGGAACTCAAGGATGCCCAGGCTGGGAAGGAGCCAGGGGGGAGCAGGGCTCACTCCAGCCACCTGAAGTCCAAAAAGGGTCAGTCTACCTCCCGCCATAAAAAACTCATGTTCAAGACAGAAGGGCCTGACTCAGACTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T69823-Ab Anti-TP53 Y220C monoclonal antibody
    Target Antigen GM-Tg-g-T69823-Ag TP53 Y220C/TP53 protein
    ORF Viral Vector pGMLP005729 Human TP53 Lentivirus plasmid
    ORF Viral Vector pGMLV001164 Human TP53 Lentivirus plasmid
    ORF Viral Vector pGMLV001491 Human TP53 Lentivirus plasmid
    ORF Viral Vector pGMLV002147 Human TP53 Lentivirus plasmid
    ORF Viral Vector pGMAD000013 Human TP53 Adenovirus plasmid
    ORF Viral Vector pGMAD000926 Human TP53 Adenovirus plasmid
    ORF Viral Vector pGMAAV000014 Human TP53 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV001555 Human TP53 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAP000334 Human TP53 Adenovirus plasmid
    ORF Viral Vector pGMLP-SPh-014 Human TP53 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-154 Human TP53 Adenovirus plasmid
    ORF Viral Vector pGMPC000186 Human TP53 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000925 Human TP53 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC004757 Human TP53 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC004811 Human TP53 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP005729 Human TP53 Lentivirus particle
    ORF Viral Vector vGMLV001164 Human TP53 Lentivirus particle
    ORF Viral Vector vGMLV001491 Human TP53 Lentivirus particle
    ORF Viral Vector vGMLV002147 Human TP53 Lentivirus particle
    ORF Viral Vector vGMAD000013 Human TP53 Adenovirus particle
    ORF Viral Vector vGMAD000926 Human TP53 Adenovirus particle
    ORF Viral Vector vGMAAV000014 Human TP53 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV001555 Human TP53 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAP000334 Human TP53 Adenovirus particle
    ORF Viral Vector vGMLP-SPh-014 Human TP53 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-154 Human TP53 Adenovirus particle


    Target information

    Target ID GM-T69823
    Target Name TP53 Y220C
    Gene ID 7157, 22059, 716170, 24842, 493847, 403869, 281542, 100062044
    Gene Symbol and Synonyms bbl,BCC7,bfy,bhy,BMFS5,LFS1,p44,P53,TP53,TRP53
    Uniprot Accession P04637
    Uniprot Entry Name P53_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Lung Cancer, lung cancers, Lung cancer, Lung, Colon cancer, Bone metastasis, Liver neoplasms, Lung neoplasms
    Gene Ensembl ENSG00000141510
    Target Classification Checkpoint-Immuno Oncology

    This gene encodes a tumor suppressor protein containing transcriptional activation, DNA binding, and oligomerization domains. The encoded protein responds to diverse cellular stresses to regulate expression of target genes, thereby inducing cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. Mutations in this gene are associated with a variety of human cancers, including hereditary cancers such as Li-Fraumeni syndrome. Alternative splicing of this gene and the use of alternate promoters result in multiple transcript variants and isoforms. Additional isoforms have also been shown to result from the use of alternate translation initiation codons from identical transcript variants (PMIDs: 12032546, 20937277). [provided by RefSeq, Dec 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.