Human LRP1/APOER/CD91 ORF/cDNA clone-Adenovirus plasmid (BC045107)

SKU: pGMAP000292
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human LRP1/APOER/CD91 adenoviral expression plasmid for LRP1 adenovirus packaging, LRP1 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

pdf MSDS
pdf Datasheet
pdf Terms of Use
Target products collection

Go to LRP-1/LRP1/APOER products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free


Product Description

Catalog ID pGMAP000292
Gene Name LRP1
Accession Number BC045107
Gene ID 4035
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 879 bp
Gene Alias APOER,CD91,LRP,TGFBR5
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Kanamycin
Sequence ATGCTGACCCCGCCGTTGCTCCTGCTGCTGCCCCTGCTCTCAGCTCTGGTCGCGGCGGCTATCGACGCCCCTAAGACTTGCAGCCCCAAGCAGTTTGCCTGCAGAGATCAAATAACCTGTATCTCAAAGGGCTGGCGGTGCGACGGTGAGAGGGACTGCCCAGACGGATCTGACGAGGCCCCTGAGATTTGTCCACAGAGTAAGGCCCAGCGATGCCAGCCAAACGAGCATAACTGCCTGGGTACTGAGCTGTGTGTTCCCATGTCCCGCCTCTGCAATGGGGTCCAGGACTGCATGGACGGCTCAGATGAGGGGCCCCACTGCCGAGAGCTCCAAGGCAACTGCTCTCGCCTGGGCTGCCAGCACCATTGTGTCCCCACACTCGATGGGCCCACCTGCTACTGCAACAGCAGCTTTCAGCTTCAGGCAGATGGCAAGACCTGCAAAGATTTTGATGAGTGCTCAGTGTACGGCACCTGCAGCCAGCTATGCACCAACACAGACGGCTCCTTCATATGTGGCTGTGTTGAAGGATACCTCCTGCAGCCGGATAACCGCTCCTGCAAGGCCAAGAACGAGCCAGTAGACCGGCCCCCTGTGCTGTTGATAGCCAACTCCCAGAACATCTTGGCCACGTACCTGAGTGGGGCCCAGGTGTCTACCATCACACCTACGAGCACGCGGCAGACCACAGCCATGGACTTCAGCTATGCCAACGAGACCGTATGCTGGGTGCATGTTGGGGACAGTGCTGCTCAGACGCAGCTCAAGTGTGCCCGCATGCCTGGCCTAAAGGGCTTCGTGGATGAGCACACCATCAACATCTCCCTCAGTCTGCACCTGTGTGTGTTTTCGAAATCACAACAGGAAATGGGGTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T91130-Ab Anti-LRP1/ LRP-1/ A2MR monoclonal antibody
    Target Antigen GM-Tg-g-T91130-Ag LRP-1/LRP1 VLP (virus-like particle)
    ORF Viral Vector pGMAP000292 Human LRP1 Adenovirus plasmid
    ORF Viral Vector vGMAP000292 Human LRP1 Adenovirus particle


    Target information

    Target ID GM-T91130
    Target Name LRP-1
    Gene ID 4035, 16971, 710965, 299858, 101090780, 481124, 533894, 100052936
    Gene Symbol and Synonyms A2MR,APOER,APR,b2b1554Clo,CD91,IGFBP-3R,IGFBP3R,IGFBP3R1,KPA,LRP,LRP-1,LRP1,LRP1A,TGFBR5
    Uniprot Accession Q07954
    Uniprot Entry Name LRP1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000123384
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a member of the low-density lipoprotein receptor family of proteins. The encoded preproprotein is proteolytically processed by furin to generate 515 kDa and 85 kDa subunits that form the mature receptor (PMID: 8546712). This receptor is involved in several cellular processes, including intracellular signaling, lipid homeostasis, and clearance of apoptotic cells. In addition, the encoded protein is necessary for the alpha 2-macroglobulin-mediated clearance of secreted amyloid precursor protein and beta-amyloid, the main component of amyloid plaques found in Alzheimer patients. Expression of this gene decreases with age and has been found to be lower than controls in brain tissue from Alzheimer's disease patients. [provided by RefSeq, Oct 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.