Human TSHR/hTSHR-I/LGR3 ORF/cDNA clone-Adenovirus plasmid (BC024205)

Cat. No.: pGMAP000258
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TSHR/hTSHR-I/LGR3 adenoviral expression plasmid for TSHR adenovirus packaging, TSHR adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to TSHR/hTSHR-I products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAP000258
Gene Name TSHR
Accession Number BC024205
Gene ID 7253
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 762 bp
Gene Alias hTSHR-I,LGR3
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGAGGCCGGCGGACTTGCTGCAGCTGGTGCTGCTGCTCGACCTGCCCAGGGACCTGGGCGGAATGGGGTGTTCGTCTCCACCCTGCGAGTGCCATCAGGAGGAGGACTTCAGAGTCACCTGCAAGGATATTCAACGCATCCCCAGCTTACCGCCCAGTACGCAGACTCTGAAGCTTATTGAGACTCACCTGAGAACTATTCCAAGTCATGCATTTTCTAATCTGCCCAATATTTCCAGAATCTACGTATCTATAGATGTGACTCTGCAGCAGCTGGAATCACACTCCTTCTACAATTTGAGTAAAGTGACTCACATAGAAATTCGGAATACCAGGAACTTAACTTACATAGACCCTGATGCCCTCAAAGAGCTCCCCCTCCTAAAGTTCCTTGGCATTTTCAACACTGGACTTAAAATGTTCCCTGACCTGACCAAAGTTTATTCCACTGATATATTCTTTATACTTGAAATTACAGACAACCCTTACATGACGTCAATCCCTGTGAATGCTTTTCAGGGACTATGCAATGAAACCTTGACACTGAAGCTGTACAACAATGGCTTTACTTCAGTCCAAGGATATGCTTTCAATGGGACAAAGCTGGATGCTGTTTACCTAAACAAGAATAAATACCTGACAGTTATTGACAAAGATGCATTTGGAGGAGTATACAGTGGACCAAGCTTGCTGCTACCTCTTGGAAGAAAGTCCTTGTCCTTTGAGACTCAGAAGGCCCCACGCTCCAGTATGCCATCATGA
ORF Protein Sequence MRPADLLQLVLLLDLPRDLGGMGCSSPPCECHQEEDFRVTCKDIQRIPSLPPSTQTLKLIETHLRTIPSHAFSNLPNISRIYVSIDVTLQQLESHSFYNLSKVTHIEIRNTRNLTYIDPDALKELPLLKFLGIFNTGLKMFPDLTKVYSTDIFFILEITDNPYMTSIPVNAFQGLCNETLTLKLYNNGFTSVQGYAFNGTKLDAVYLNKNKYLTVIDKDAFGGVYSGPSLLLPLGRKSLSFETQKAPRSSMPS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T60606-Ab Anti-TSHR/ CHNG1/ LGR3 monoclonal antibody
    Target Antigen GM-Tg-g-T60606-Ag TSHR VLP (virus-like particle)
    ORF Viral Vector pGMLV000899 Human TSHR Lentivirus plasmid
    ORF Viral Vector pGMLV001265 Human TSHR Lentivirus plasmid
    ORF Viral Vector pGMAAV001175 Human TSHR Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAP000258 Human TSHR Adenovirus plasmid
    ORF Viral Vector pGMPC001308 Human TSHR Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000899 Human TSHR Lentivirus particle
    ORF Viral Vector vGMLV001265 Human TSHR Lentivirus particle
    ORF Viral Vector vGMAAV001175 Human TSHR Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAP000258 Human TSHR Adenovirus particle


    Target information

    Target ID GM-T60606
    Target Name TSHR
    Gene ID 7253, 22095, 574251, 25360, 493842, 403968, 281553, 111770367
    Gene Symbol and Synonyms CHNG1,hTSHR-I,hypothroid,hyt,LGR3,pet,TSH-R,TSHR,TSHRA
    Uniprot Accession P16473
    Uniprot Entry Name TSHR_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Cancer
    Gene Ensembl ENSG00000165409
    Target Classification Checkpoint-Immuno Oncology, GPCR, Tumor-associated antigen (TAA)

    The protein encoded by this gene is a membrane protein and a major controller of thyroid cell metabolism. The encoded protein is a receptor for thyrothropin and thyrostimulin, and its activity is mediated by adenylate cyclase. Defects in this gene are a cause of several types of hyperthyroidism. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.