Human CCKBR/CCK-B/GASR ORF/cDNA clone-Adenovirus plasmid (BC000740)

Cat. No.: pGMAP000136
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CCKBR/CCK-B/GASR adenoviral expression plasmid for CCKBR adenovirus packaging, CCKBR adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to CCKBR/CCK-B products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAP000136
Gene Name CCKBR
Accession Number BC000740
Gene ID 887
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 1344 bp
Gene Alias CCK-B,GASR
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGGAGCTGCTAAAGCTGAACCGGAGCGTGCAGGGAACCGGACCCGGGCCGGGGGCTTCCCTGTGCCGCCCGGGGGCGCCTCTCCTCAACAGCAGCAGTGTGGGCAACCTCAGCTGCGAGCCCCCTCGCATTCGCGGAGCCGGGACACGAGAATTGGAGCTGGCCATTAGAATCACTCTTTACGCAGTGATCTTCCTGATGAGCGTTGGAGGAAATATGCTCATCATCGTGGTCCTGGGACTGAGCCGCCGCCTGAGGACTGTCACCAATGCCTTCCTCCTCTCACTGGCAGTCAGCGACCTCCTGCTGGCTGTGGCTTGCATGCCCTTCACCCTCCTGCCCAATCTCATGGGCACATTCATCTTTGGCACCGTCATCTGCAAGGCGGTTTCCTACCTCATGGGGGTGTCTGTGAGTGTGTCTACGCTAAGCCTCGTGGCCATCGCACTGGAGCGGTACAGCGCCATCTGCCGACCACTGCAGGCACGAGTGTGGCAGACGCGCTCCCACGCGGCTCGCGTGATTGTAGCCACGTGGCTGCTGTCCGGACTACTCATGGTGCCCTACCCCGTGTACACTGTCGTGCAACCAGTGGGGCCTCGTGTGCTGCAGTGCGTGCATCGCTGGCCCAGTGCGCGGGTCCGCCAGACCTGGTCCGTACTGCTGCTTCTGCTCTTGTTCTTCATCCCGGGTGTGGTTATGGCCGTGGCCTACGGGCTTATCTCTCGCGAGCTCTACTTAGGGCTTCGCTTTGACGGCGACAGTGACAGCGACAGCCAAAGCAGGGTCCGAAACCAAGGCGGGCTGCCAGGGGCTGTTCACCAGAACGGGCGTTGCCGGCCTGAGACTGGCGCGGTTGGCGAAGACAGCGATGGCTGCTACGTGCAACTTCCACGTTCCCGGCCTGCCCTGGAGCTGACGGCGCTGACGGCTCCTGGGCCGGGATCCGGCTCCCGGCCCACCCAGGCCAAGCTGCTGGCTAAGAAGCGCGTGGTGCGAATGTTGCTGGTGATCGTTGTGCTTTTTTTTCTGTGTTGGTTGCCAGTTTATAGTGCCAACACGTGGCGCGCCTTTGATGGCCCGGGTGCACACCGAGCACTCTCGGGTGCTCCTATCTCCTTCATTCACTTGCTGAGCTACGCCTCGGCCTGTGTCAACCCCCTGGTCTACTGCTTCATGCACCGTCGCTTTCGCCAGGCCTGCCTGGAAACTTGCGCTCGCTGCTGCCCCCGGCCTCCACGAGCTCGCCCCAGGGCTCTTCCCGATGAGGACCCTCCCACTCCCTCCATTGCTTCGCTGTCCAGGCTTAGCTACACCACCATCAGCACACTGGGCCCTGGCTGA
ORF Protein Sequence MELLKLNRSVQGTGPGPGASLCRPGAPLLNSSSVGNLSCEPPRIRGAGTRELELAIRITLYAVIFLMSVGGNMLIIVVLGLSRRLRTVTNAFLLSLAVSDLLLAVACMPFTLLPNLMGTFIFGTVICKAVSYLMGVSVSVSTLSLVAIALERYSAICRPLQARVWQTRSHAARVIVATWLLSGLLMVPYPVYTVVQPVGPRVLQCVHRWPSARVRQTWSVLLLLLLFFIPGVVMAVAYGLISRELYLGLRFDGDSDSDSQSRVRNQGGLPGAVHQNGRCRPETGAVGEDSDGCYVQLPRSRPALELTALTAPGPGSGSRPTQAKLLAKKRVVRMLLVIVVLFFLCWLPVYSANTWRAFDGPGAHRALSGAPISFIHLLSYASACVNPLVYCFMHRRFRQACLETCARCCPRPPRARPRALPDEDPPTPSIASLSRLSYTTISTLGPG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T05849-Ab Anti-GASR/ CCKBR/ CCK-B monoclonal antibody
    Target Antigen GM-Tg-g-T05849-Ag CCKBR VLP (virus-like particle)
    ORF Viral Vector pGMLP004002 Human CCKBR Lentivirus plasmid
    ORF Viral Vector pGMLV002240 Human CCKBR Lentivirus plasmid
    ORF Viral Vector pGMAP000136 Human CCKBR Adenovirus plasmid
    ORF Viral Vector vGMLP004002 Human CCKBR Lentivirus particle
    ORF Viral Vector vGMLV002240 Human CCKBR Lentivirus particle
    ORF Viral Vector vGMAP000136 Human CCKBR Adenovirus particle


    Target information

    Target ID GM-T05849
    Target Name CCKBR
    Gene ID 887, 12426, 712939, 25706, 101098743, 485333, 281665, 100055073
    Gene Symbol and Synonyms CCK-B,CCK-BR,CCK2-R,CCK2R,CCKBR,CCKR-2,Cholrec,GASR
    Uniprot Accession P32239
    Uniprot Entry Name GASR_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000110148
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a G-protein coupled receptor for gastrin and cholecystokinin (CCK), regulatory peptides of the brain and gastrointestinal tract. This protein is a type B gastrin receptor, which has a high affinity for both sulfated and nonsulfated CCK analogs and is found principally in the central nervous system and the gastrointestinal tract. Alternative splicing results in multiple transcript variants. A misspliced transcript variant including an intron has been observed in cells from colorectal and pancreatic tumors. [provided by RefSeq, Dec 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.