Human TGFA/TFGA ORF/cDNA clone-Adenovirus plasmid (BC005308)

SKU: pGMAP000120
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TGFA/TFGA adenoviral expression plasmid for TGFA adenovirus packaging, TGFA adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

pdf MSDS
pdf Datasheet
pdf Terms of Use
Target products collection

Go to TGFA/TFGA products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free


Product Description

Catalog ID pGMAP000120
Gene Name TGFA
Accession Number BC005308
Gene ID 7039
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 480 bp
Gene Alias TFGA
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Kanamycin
Sequence ATGGTCCCCTCGGCTGGACAGCTCGCCCTGTTCGCTCTGGGTATTGTGTTGGCTGCGTGCCAGGCCTTGGAGAACAGCACGTCCCCGCTGAGTGACCCGCCCGTGGCTGCAGCAGTGGTGTCCCATTTTAATGACTGCCCAGATTCCCACACTCAGTTCTGCTTCCATGGAACCTGCAGGTTTTTGGTGCAGGAGGACAAGCCAGCATGTGTCTGCCATTCTGGGTACGTTGGTGCACGCTGTGAGCATGCGGACCTCCTGGCCGTGGTGGCTGCCAGCCAGAAGAAGCAGGCCATCACCGCCTTGGTGGTGGTCTCCATCGTGGCCCTGGCTGTCCTTATCATCACATGTGTGCTGATACACTGCTGCCAGGTCCGAAAACACTGTGAGTGGTGCCGGGCCCTCATCTGCCGGCACGAGAAGCCCAGCGCCCTCCTGAAGGGAAGAACCGCTTGCTGCCACTCAGAAACAGTGGTCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T00033-Ab Anti-TGFA/ TFGA monoclonal antibody
    Target Antigen GM-Tg-g-T00033-Ag TGFA VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T00033 transforming growth factor, alpha (TGFA) protein & antibody
    ORF Viral Vector pGMLP000405 Human TGFA Lentivirus plasmid
    ORF Viral Vector pGMAP000120 Human TGFA Adenovirus plasmid
    ORF Viral Vector vGMLP000405 Human TGFA Lentivirus particle
    ORF Viral Vector vGMAP000120 Human TGFA Adenovirus particle


    Target information

    Target ID GM-T00033
    Target Name TGFA
    Gene ID 7039, 21802, 613031, 24827, 101094921, 403431, 540388, 100060423
    Gene Symbol and Synonyms RATTGFAA,TFGA,TGF alpha,TGFA,TGFAA,wa-1,wa1
    Uniprot Accession P01135
    Uniprot Entry Name TGFA_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Cytokine Target
    Disease cancer patients
    Gene Ensembl ENSG00000163235
    Target Classification Not Available

    This gene encodes a growth factor that is a ligand for the epidermal growth factor receptor, which activates a signaling pathway for cell proliferation, differentiation and development. This protein may act as either a transmembrane-bound ligand or a soluble ligand. This gene has been associated with many types of cancers, and it may also be involved in some cases of cleft lip/palate. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.