Human C5AR1/C5A/C5AR ORF/cDNA clone-Adenovirus plasmid (BC008982)
Cat. No.: pGMAP000035
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human C5AR1/C5A/C5AR adenoviral expression plasmid for C5AR1 adenovirus packaging, C5AR1 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go to
C5AR1/C5A products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMAP000035 |
Gene Name | C5AR1 |
Accession Number | BC008982 |
Gene ID | 728 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 1053 bp |
Gene Alias | C5A,C5AR,CD88 |
Fluorescent Reporter | GFP |
Mammalian Cell Selection | Null |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | EF1 |
Resistance | Kanamycin |
ORF Nucleotide Sequence | ATGAACTCCTTCAATTATACCACCCCTGATTATGGGCACTATGATGACAAGGATACCCTGGACCTCAACACCCCTGTGGATAAAACTTCTAACACGCTGCGTGTTCCAGACATCCTGGCCTTGGTCATCTTTGCAGTCGTCTTCCTGGTGGGAGTGCTGGGCAATGCCCTGGTGGTCTGGGTGACGGCATTCGAGGCCAAGCGGACCATCAATGCCATCTGGTTCCTCAACTTGGCGGTAGCCGACTTCCTCTCCTGCCTGGCGCTGCCCATCTTGTTCACGTCCATTGTACAGCATCACCACTGGCCCTTTGGCGGGGCCGCCTGCAGCATCCTGCCCTCCCTCATCCTGCTCAACATGTACGCCAGCATCCTGCTCCTGGCCACCATCAGCGCCGACCGCTTTCTGCTGGTGTTTAAACCCATCTGGTGCCAGAACTTCCGAGGGGCCGGCTTGGCCTGGATCGCCTGTGCCGTGGCTTGGGGTTTAGCCCTGCTGCTGACCATACCCTCCTTCCTGTACCGGGTGGTCCGGGAGGAGTACTTTCCACCAAAGGTGTTGTGTGGCGTGGACTACAGCCACGACAAACGGCGGGAGCGAGCCGTGGCCATCGTCCGGCTGGTCCTGGGCTTCCTGTGGCCTCTACTCACGCTCACGATTTGTTACACTTTCATCCTGCTCCGGACGTGGAGCCGCAGGGCCACGCGGTCCACCAAGACACTCAAGGTGGTGGTGGCAGTGGTGGCCAGTTTCTTTATCTTCTGGTTGCCCTACCAGGTGACGGGGATAATGATGTCCTTCCTGGAGCCATCGTCACCCACCTTCCTGCTGCTGAATAAGCTGGACTCCCTGTGTGTCTCCTTTGCCTACATCAACTGCTGCATCAACCCCATCATCTACGTGGTGGCCGGCCAGGGCTTCCAGGGCCGACTGCGGAAATCCCTCCCCAGCCTCCTCCGGAACGTGTTGACTGAAGAGTCCGTGGTTAGGGAGAGCAAGTCATTCACGCGCTCCACAGTGGACACTATGGCCCAGAAGACCCAGGCAGTGTAG |
ORF Protein Sequence | MNSFNYTTPDYGHYDDKDTLDLNTPVDKTSNTLRVPDILALVIFAVVFLVGVLGNALVVWVTAFEAKRTINAIWFLNLAVADFLSCLALPILFTSIVQHHHWPFGGAACSILPSLILLNMYASILLLATISADRFLLVFKPIWCQNFRGAGLAWIACAVAWGLALLLTIPSFLYRVVREEYFPPKVLCGVDYSHDKRRERAVAIVRLVLGFLWPLLTLTICYTFILLRTWSRRATRSTKTLKVVVAVVASFFIFWLPYQVTGIMMSFLEPSSPTFLLLNKLDSLCVSFAYINCCINPIIYVVAGQGFQGRLRKSLPSLLRNVLTEESVVRESKSFTRSTVDTMAQKTQAV |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-ab-039 | Pre-Made Avdoralimab biosimilar, Whole mAb, Anti-C5AR1 Antibody: Anti-C5AR/C5R1/CD88 therapeutic antibody |
Target Antibody | GM-Tg-g-T15439-Ab | Anti-C5AR1/ C5A/ C5AR monoclonal antibody |
Target Antigen | GM-Tg-g-T15439-Ag | C5AR1 VLP (virus-like particle) |
ORF Viral Vector | pGMAP000035 | Human C5AR1 Adenovirus plasmid |
ORF Viral Vector | pGMAP000067 | Human C5AR1 Adenovirus plasmid |
ORF Viral Vector | vGMAP000035 | Human C5AR1 Adenovirus particle |
ORF Viral Vector | vGMAP000067 | Human C5AR1 Adenovirus particle |
Target information
Target ID | GM-T15439 |
Target Name | C5AR1 |
Gene ID | 728, 12273, 718056, 113959, 101098593, 442974, 493645, 100065997 |
Gene Symbol and Synonyms | C5A,C5a-R,C5AR,C5AR1,C5R1,CD88,D7Msu1 |
Uniprot Accession | P21730 |
Uniprot Entry Name | C5AR1_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target, INN Index |
Disease | Not Available |
Gene Ensembl | ENSG00000197405 |
Target Classification | Checkpoint-Immuno Oncology, GPCR |
Enables G protein-coupled receptor activity and complement component C5a receptor activity. Involved in several processes, including complement component C5a signaling pathway; mRNA transcription by RNA polymerase II; and positive regulation of ERK1 and ERK2 cascade. Located in apical part of cell and basolateral plasma membrane. Biomarker of Alzheimer's disease; asthma; chronic obstructive pulmonary disease; rhinitis; and severe acute respiratory syndrome. [provided by Alliance of Genome Resources, Apr 2022]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.