Human METRNL ORF/cDNA clone-Adeno-associate virus(AAV) plasmid (NM_001004431.3)

Cat. No.: pGMAAV000374
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human METRNL/ Adeno-associated virus expression plasmid (ITR-vector) for METRNL AAV packaging, METRNL AAV production.The purified Human METRNL/ AAV particle serves as an invaluable asset for in-depth in vivo METRNL studies, mechanism of action (MOA) research, and the evolution of METRNL-associated gene therapy strategies.

Our GM-AAV ITR vector is optimized with the G-NEXT™ multi-serotypes AAV vector system. Explore the G-NEXT™ system in detail.


Target products collection

Go to METRNL/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAAV000374
Gene Name METRNL
Accession Number NM_001004431.3
Gene ID 284207
Species Human
Product Type Adeno-associate virus(AAV) plasmid (overexpression)
Insert Length 936 bp
Gene Alias
Fluorescent Reporter Null
Mammalian Cell Selection Null
Fusion Tag Null
Promoter CTNT
Resistance Amplicin
ORF Nucleotide Sequence ATGCGGGGCGCGGCGCGGGCGGCCTGGGGGCGCGCGGGGCAGCCGTGGCCGCGACCCCCCGCCCCGGGCCCGCCCCCGCCGCCGCTCCCGCTGCTGCTCCTGCTCCTGGCCGGGCTGCTGGGCGGCGCGGGCGCGCAGTACTCCAGCGACCGGTGCAGCTGGAAGGGGAGCGGGCTGACGCACGAGGCACACAGGAAGGAGGTGGAGCAGGTGTATCTGCGCTGTGCGGCGGGTGCCGTGGAGTGGATGTACCCAACAGGTGCTCTCATCGTTAACCTGCGGCCCAACACCTTCTCGCCTGCCCGGCACCTGACCGTGTGCATCAGGTCCTTCACGGACTCCTCGGGGGCCAATATTTATTTGGAAAAAACTGGAGAACTGAGACTGCTGGTACCAGACGGGGACGGCAGGCCCGGCCGGGTGCAGTGTTTTGGCCTGGAGCAGGGCGGCCTGTTCGTGGAGGCCACGCCGCAGCAGGATATCGGCCGGAGGACCACAGGCTTCCAGTACGAGCTGGTTAGGAGGCACAGGGCGTCGGACCTGCACGAGCTGTCTGCGCCGTGCCGTCCCTGCAGTGACACCGAGGTGCTCCTAGCCGTCTGCACCAGCGACTTCGCCGTTCGAGGCTCCATCCAGCAAGTTACCCACGAGCCTGAGCGGCAGGACTCAGCCATCCACCTGCGCGTGAGCAGACTCTATCGGCAGAAAAGCAGGGTCTTCGAGCCGGTGCCCGAGGGTGACGGCCACTGGCAGGGGCGCGTCAGGACGCTGCTGGAGTGTGGCGTGCGGCCGGGGCATGGCGACTTCCTCTTCACTGGCCACATGCACTTCGGGGAGGCGCGGCTCGGCTGTGCCCCACGCTTCAAGGACTTCCAGAGGATGTACAGGGATGCCCAGGAGAGGGGGCTGAACCCTTGTGAGGTTGGCACGGACTGA
ORF Protein Sequence MRGAARAAWGRAGQPWPRPPAPGPPPPPLPLLLLLLAGLLGGAGAQYSSDRCSWKGSGLTHEAHRKEVEQVYLRCAAGAVEWMYPTGALIVNLRPNTFSPARHLTVCIRSFTDSSGANIYLEKTGELRLLVPDGDGRPGRVQCFGLEQGGLFVEATPQQDIGRRTTGFQYELVRRHRASDLHELSAPCRPCSDTEVLLAVCTSDFAVRGSIQQVTHEPERQDSAIHLRVSRLYRQKSRVFEPVPEGDGHWQGRVRTLLECGVRPGHGDFLFTGHMHFGEARLGCAPRFKDFQRMYRDAQERGLNPCEVGTD

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1096-Ab Anti-METRL/ METRNL functional antibody
    Target Antigen GM-Tg-g-SE1096-Ag METRNL protein
    ORF Viral Vector pGMLP005024 Human METRNL Lentivirus plasmid
    ORF Viral Vector pGMAAV000374 Human METRNL Adeno-associate virus(AAV) plasmid
    ORF Viral Vector vGMLP005024 Human METRNL Lentivirus particle
    ORF Viral Vector vGMAAV000374 Human METRNL Adeno-associate virus(AAV) particle


    Target information

    Target ID GM-SE1096
    Target Name METRNL
    Gene ID 284207, 210029, 719751, 316842, 101084587, 608424, 534297, 100056359
    Gene Symbol and Synonyms 9430048M07Rik,METRNL
    Uniprot Accession Q641Q3
    Uniprot Entry Name METRL_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000176845
    Target Classification Not Available

    Predicted to enable hormone activity. Predicted to be involved in several processes, including brown fat cell differentiation; energy homeostasis; and positive regulation of brown fat cell differentiation. Located in extracellular exosome. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.