Mouse Igfbp2/AI255832/IBP-2 ORF/cDNA clone-Lentivirus particle (NM_008342)

Cat. No.: vGMLPm003848

Pre-made Mouse Igfbp2/AI255832/IBP-2 Lentiviral expression plasmid for Igfbp2 lentivirus packaging, Igfbp2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLPm003848 Mouse Igfbp2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLPm003848
Gene Name Igfbp2
Accession Number NM_008342
Gene ID 16008
Species Mouse
Product Type Lentivirus particle (overexpression)
Insert Length 918 bp
Gene Alias AI255832,IBP-2,Igfbp-2,mIGFBP-2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCTGCCGAGATTGGGCGGCCCCGCGCTGCCGCTGCTCCTGCCGTCGTTGCTCTTGCTGCTGCTCTTGGGCGCGGGCGGCTGCGGCCCCGGGGTGCGCGCCGAGGTGCTGTTCCGCTGCCCACCCTGCACGCCCGAGCGTCTGGCCGCTTGCGGGCCCCCACCCGACGCGCCCTGCGCCGAGCTGGTGCGAGAGCCCGGCTGCGGCTGCTGCTCCGTGTGCGCACGGCAGGAGGGCGAAGCATGCGGCGTCTACATCCCGCGCTGCGCCCAGACGCTACGCTGCTATCCCAACCCGGGCTCCGAGCTGCCCCTGAAGGCGCTTGTCACAGGCGCGGGTACCTGTGAAAAGAGACGCGTGGGCACCACCCCACAGCAGGTTGCAGACAGTGATGACGACCACTCTGAGGGAGGCCTGGTGGAGAACCACGTGGATGGGACCATGAACATGTTGGGAGGTGGTAGCAGTGCTGGCCGGAAGCCCCTCAAGTCAGGCATGAAGGAGCTGGCTGTGTTCCGGGAGAAGGTCAATGAACAGCACCGGCAGATGGGCAAGGGTGCCAAACACCTCAGTCTGGAGGAGCCCAAGAAGTTGCGCCCGCCTCCCGCCAGGACCCCTTGCCAGCAGGAGTTGGACCAGGTCCTGGAGCGGATCTCCACCATGCGCCTTCCGGATGATCGGGGCCCCCTGGAACATCTCTACTCCCTGCACATCCCCAACTGTGACAAGCATGGCCGGTACAACCTTAAGCAGTGCAAGATGTCTCTGAACGGACAGCGCGGGGAGTGCTGGTGTGTGAACCCCAATACCGGGAAGCCCATCCAGGGAGCTCCCACCATCCGGGGAGACCCCGAGTGCCATCTCTTCTACAACGAGCAGCAGGAGACTGGTGGGGCCCATGCCCAAAGTGTGCAGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    ORF Viral Vector pGMLPm003848 Mouse Igfbp2 Lentivirus plasmid




    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.