Rat Gja1/Cx43/ Cxnk1 ORF/cDNA clone-Adenovirus particle (NM_012567.2)
Pre-made Rat Gja1/Cx43/ Cxnk1 Adenovirus for Gja1 overexpression in-vitro and in-vivo. The Gja1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified Gja1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to GJA1/Gja1/Cx43 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAD000713 | Rat Gja1 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAD000713 |
Gene Name | Gja1 |
Accession Number | NM_012567.2 |
Gene ID | 24392 |
Species | Rat |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 1149 bp |
Gene Alias | Cx43, Cxnk1 |
Fluorescent Reporter | |
Mammalian Cell Selection | Null |
Fusion Tag | Null |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGTGACTGGAGTGCCTTGGGGAAGCTTCTGGACAAGGTCCAAGCCTACTCCACCGCTGGAGGGAAGGTGTGGCTGTCAGTGCTCTTCATATTCAGAATCCTGCTCCTGGGGACAGCTGTTGAGTCAGCTTGGGGTGATGAACAGTCTGCCTTTCGCTGTAACACTCAACAACCTGGCTGCGAAAACGTCTGCTATGACAAGTCCTTCCCCATCTCTCACGTGCGCTTCTGGGTCCTTCAGATCATATTCGTGTCTGTGCCCACCCTCCTGTACTTGGCCCATGTGTTCTATGTGATGAGGAAGGAAGAGAAGCTAAACAAGAAAGAAGAGGAGCTCAAAGTGGCCCAGACTGACGGGGTCAACGTGGAGATGCACCTGAAGCAGATTGAAATCAAGAAGTTCAAGTACGGGATTGAAGAGCACGGCAAGGTGAAAATGAGGGGCGGCTTGCTGAGAACCTACATCATCAGCATCCTCTTCAAGTCTGTCTTCGAGGTGGCCTTCCTGCTCATCCAGTGGTACATCTATGGGTTCAGCTTGAGCGCGGTCTACACCTGCAAGAGAGATCCCTGCCCCCACCAGGTAGACTGCTTCCTCTCACGTCCCACGGAGAAAACCATCTTCATCATCTTCATGCTGGTGGTGTCCTTGGTGTCTCTCGCTTTGAACATCATTGAGCTCTTCTACGTCTTCTTCAAAGGCGTTAAGGATCGCGTGAAGGGAAGAAGCGATCCTTACCACGCCACCACTGGCCCACTGAGCCCATCAAAAGACTGCGGATCTCCAAAATACGCCTACTTCAATGGCTGCTCCTCACCAACGGCTCCACTCTCGCCTATGTCTCCTCCTGGGTACAAGCTGGTTACTGGTGACAGAAACAATTCCTCGTGCCGCAATTACAACAAGCAAGCTAGCGAGCAAAACTGGGCGAACTACAGCGCAGAGCAAAATCGCATGGGGCAGGCCGGAAGCACCATCTCCAACTCGCACGCCCAGCCGTTCGATTTCCCCGACGACAACCAGAATGCCAAAAAAGTTGCTGCTGGACATGAACTCCAGCCATTAGCCATCGTGGACCAACGACCTTCCAGCAGAGCCAGCAGCCGCGCCAGCAGCAGGCCTCGGCCTGATGACCTGGAGATTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T44479-Ab | Anti-CXA1/ GJA1/ AVSD3 monoclonal antibody |
Target Antigen | GM-Tg-g-T44479-Ag | GJA1 VLP (virus-like particle) |
ORF Viral Vector | pGMLV000455 | Human GJA1 Lentivirus plasmid |
ORF Viral Vector | pGMLV001053 | Human GJA1 Lentivirus plasmid |
ORF Viral Vector | pGMLV001055 | Human GJA1 Lentivirus plasmid |
ORF Viral Vector | pGMLV001661 | Rat Gja1 Lentivirus plasmid |
ORF Viral Vector | pGMAD000713 | Rat Gja1 Adenovirus plasmid |
ORF Viral Vector | pGMAD001175 | Human GJA1 Adenovirus plasmid |
ORF Viral Vector | pGMLP001348 | Human GJA1 Lentivirus plasmid |
ORF Viral Vector | pGMAP000184 | Human GJA1 Adenovirus plasmid |
ORF Viral Vector | vGMLV000455 | Human GJA1 Lentivirus particle |
ORF Viral Vector | vGMLV001053 | Human GJA1 Lentivirus particle |
ORF Viral Vector | vGMLV001055 | Human GJA1 Lentivirus particle |
ORF Viral Vector | vGMLV001661 | Rat Gja1 Lentivirus particle |
ORF Viral Vector | vGMAD000713 | Rat Gja1 Adenovirus particle |
ORF Viral Vector | vGMAD001175 | Human GJA1 Adenovirus particle |
ORF Viral Vector | vGMLP001348 | Human GJA1 Lentivirus particle |
ORF Viral Vector | vGMAP000184 | Human GJA1 Adenovirus particle |
ORF Viral Vector | pGMLV002512 | Human GJA1 Lentivirus plasmid |
Target information
Target ID | GM-T44479 |
Target Name | GJA1 |
Gene ID | 2697, 14609, 714344, 24392, 101100211, 403418, 281193, 100067229 |
Gene Symbol and Synonyms | AVSD3,CMDR,Cnx43,connexin43,CX43,Cx43alpha1,Cxnk1,EKVP,EKVP3,Gja-1,GJA1,GJAL,HLHS1,HSS,Npm1,ODDD,PPKCA |
Uniprot Accession | P17302 |
Uniprot Entry Name | CXA1_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000152661 |
Target Classification | Tumor-associated antigen (TAA) |
This gene is a member of the connexin gene family. The encoded protein is a component of gap junctions, which are composed of arrays of intercellular channels that provide a route for the diffusion of low molecular weight materials from cell to cell. The encoded protein is the major protein of gap junctions in the heart that are thought to have a crucial role in the synchronized contraction of the heart and in embryonic development. A related intronless pseudogene has been mapped to chromosome 5. Mutations in this gene have been associated with oculodentodigital dysplasia, autosomal recessive craniometaphyseal dysplasia and heart malformations. [provided by RefSeq, May 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.