Rat Atf4 ORF/cDNA clone-Adeno-associate virus(AAV) particle (NM_024403.2)
Pre-made Rat Atf4/ Adeno-associated virus particle for Atf4 in-vivo study, mechanism of action (MOA) research and Atf4-associated gene therapy development.
At GM Vector Core (GMVC), we stand at the forefront of custom AAV development and produce distinct grades of AAVs employing state-of-the-art methodologies. Uncover more about our expertise.
Go
to ATF-4/Atf4/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | AAV serotype | AAV Grade | AAV quantity |
vGMAAV000923 | Rat Atf4 Adeno-associate virus(AAV) particle | AAV1, AAV2, AAV2 variant (Y444F), AAV2 variant (Y272F, Y444F, Y500F, Y730F), AAV2 variant (Y444F, Y730F, Y500F, Y272F, Y704F, Y252F), AAV2 variant(AAV2.7m8), AAV5, AAV6, AAV8, AAV8-1m, AAV8-2m, AAV8 variant (Y733F, Y447F, Y275), AAV9, AAV-Rh.10, AAV-DJ, AAV-DJ/8, AAV-Retro (Retrograde), AAV9-PHP.B, AAV9-PHP.eB, AAV9-PHP.S, AAV-BR1, AAV-2i8, AAV-SIG, AAV-VEC, AAV4, AAV6.2, AAV6.2FF | Pilot Grade | 1.0E+12VG/ml |
5.0E+12VG/ml | ||||
1E+13VG/ml | ||||
5E+13VG/ml | ||||
1E+14VG/ml | ||||
Research Grade | 1.0E+12VG/ml | |||
5.0E+12VG/ml | ||||
1E+13VG/ml | ||||
5E+13VG/ml | ||||
1E+14VG/ml | ||||
GMP-like Grade | inquiry | |||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAAV000923 |
Gene Name | Atf4 |
Accession Number | NM_024403.2 |
Gene ID | 79255 |
Species | Rat |
Product Type | Adeno-associate virus(AAV) particle (overexpression) |
Insert Length | 1044 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGACCGAGATGAGCTTCCTGAACAGCGAAGTGTTGGCGGGGGACTTAATGTCCCCCTTCGACCAGTCGGGTTTGGGGGCTGAAGAAAGCCTAGGTCTCTTAGATGACTATCTGGAGGTGGCCAAGCACTTCAAACCTCATGGGTTCTCCAGCGACAAGGCGGGCTCCTCAGAATGGCTGGCTATGGATGGGTTGGTCAGTGCCTCAGACACCGGCAAGGAGGATGCCTTTTCCGGGACAGATTGGATGTTGGAGAAAATGGACCTGAAAGAGTTTGACTTCGATGCTCTGTTTCGAATGGATGACCTGGAAACCATGCCAGATGAGCTTTTGGCCACGTTGGATGACACATGTGATCTTTTTGCCCCTCTAGTCCAAGAGACTAATAAGGAGCCCCCTCAGACAGTGAACCCAATTGGCCATCTCCCAGAAAGTGTAATAAAAGTCGACCAGGCTGCCCCCTTTACATTCTTGCAGCCTCTTCCCTGTTCCCCAGGGTTTCTGTCTTCCACTCCAGATCATTCCTTTAGTTTAGAGCTGGGAAGTGAGGTTGATATCTCTGAAGGAGATAGGAAGCCTGACTCTGCTGCTTATATTACTCTAACCCCTCAGTGTGTAAAGGAGGAAGACACTCCCTCTGATAGTGACAGTGGCATCTGTATGAGCCCTGAGTCCTACCTGGGCTCTCCCCAACACAGCCCTTCCACCTCCAGGGCCCCACCAGACAGTCTGCCTTCTCCAGGTGTTCCTCGTGGTTCTCGACCCAAACCTTATGACCCACCTGGAGTTAGTGTGACAGCTAAAGTGAAGACTGAAAAGTTGGATAAGAAGCTGAAAAAGATGGAGCAAAACAAGACAGCAGCTACTAGGTACCGCCAGAAGAAGAGGGCTGAGCAGGAAGCCCTCACTGGCGAGTGTAAAGAGCTAGAAAAGAAGAACGAGGCTCTGAAAGAGAAGGCAGATTCTCTCGCCAAAGAGATTCAGTATCTAAAAGACCTGATAGAAGAGGTCCGTAAGGCAAGGGGGAAGAAGAGAGTTCCTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T53270-Ab | Anti-ATF-4 monoclonal antibody |
Target Antigen | GM-Tg-g-T53270-Ag | ATF-4/ATF4 protein |
ORF Viral Vector | pGMLV000321 | Human ATF4 Lentivirus plasmid |
ORF Viral Vector | pGMLV000496 | Human ATF4 Lentivirus plasmid |
ORF Viral Vector | pGMAAV000923 | Rat Atf4 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMPC000693 | Human ATF4 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLV000321 | Human ATF4 Lentivirus particle |
ORF Viral Vector | vGMLV000496 | Human ATF4 Lentivirus particle |
ORF Viral Vector | vGMAAV000923 | Rat Atf4 Adeno-associate virus(AAV) particle |
Target information
Target ID | GM-T53270 |
Target Name | ATF-4 |
Gene ID | 468, 11911, 703965, 79255, 101084297, 474503, 509107, 100070334 |
Gene Symbol and Synonyms | Atf-4,ATF4,C/ATF,CREB-2,CREB2,TAXREB67,TXREB |
Uniprot Accession | P18848 |
Uniprot Entry Name | ATF4_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000128272 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a transcription factor that was originally identified as a widely expressed mammalian DNA binding protein that could bind a tax-responsive enhancer element in the LTR of HTLV-1. The encoded protein was also isolated and characterized as the cAMP-response element binding protein 2 (CREB-2). The protein encoded by this gene belongs to a family of DNA-binding proteins that includes the AP-1 family of transcription factors, cAMP-response element binding proteins (CREBs) and CREB-like proteins. These transcription factors share a leucine zipper region that is involved in protein-protein interactions, located C-terminal to a stretch of basic amino acids that functions as a DNA binding domain. Two alternative transcripts encoding the same protein have been described. Two pseudogenes are located on the X chromosome at q28 in a region containing a large inverted duplication. [provided by RefSeq, Sep 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.