Rat Atf4 ORF/cDNA clone-Adeno-associate virus(AAV) particle (NM_024403.2)

Pre-made Rat Atf4/ Adeno-associated virus particle for Atf4 in-vivo study, mechanism of action (MOA) research and Atf4-associated gene therapy development.

At GM Vector Core (GMVC), we stand at the forefront of custom AAV development and produce distinct grades of AAVs employing state-of-the-art methodologies. Uncover more about our expertise.

Target products collectionGo to ATF-4/Atf4/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name AAV serotype AAV Grade AAV quantity
vGMAAV000923 Rat Atf4 Adeno-associate virus(AAV) particle AAV1, AAV2, AAV2 variant (Y444F), AAV2 variant (Y272F, Y444F, Y500F, Y730F), AAV2 variant (Y444F, Y730F, Y500F, Y272F, Y704F, Y252F), AAV2 variant(AAV2.7m8), AAV5, AAV6, AAV8, AAV8-1m, AAV8-2m, AAV8 variant (Y733F, Y447F, Y275), AAV9, AAV-Rh.10, AAV-DJ, AAV-DJ/8, AAV-Retro (Retrograde), AAV9-PHP.B, AAV9-PHP.eB, AAV9-PHP.S, AAV-BR1, AAV-2i8, AAV-SIG, AAV-VEC, AAV4, AAV6.2, AAV6.2FF Pilot Grade 1.0E+12VG/ml
5.0E+12VG/ml
1E+13VG/ml
5E+13VG/ml
1E+14VG/ml
Research Grade 1.0E+12VG/ml
5.0E+12VG/ml
1E+13VG/ml
5E+13VG/ml
1E+14VG/ml
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAAV000923
Gene Name Atf4
Accession Number NM_024403.2
Gene ID 79255
Species Rat
Product Type Adeno-associate virus(AAV) particle (overexpression)
Insert Length 1044 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACCGAGATGAGCTTCCTGAACAGCGAAGTGTTGGCGGGGGACTTAATGTCCCCCTTCGACCAGTCGGGTTTGGGGGCTGAAGAAAGCCTAGGTCTCTTAGATGACTATCTGGAGGTGGCCAAGCACTTCAAACCTCATGGGTTCTCCAGCGACAAGGCGGGCTCCTCAGAATGGCTGGCTATGGATGGGTTGGTCAGTGCCTCAGACACCGGCAAGGAGGATGCCTTTTCCGGGACAGATTGGATGTTGGAGAAAATGGACCTGAAAGAGTTTGACTTCGATGCTCTGTTTCGAATGGATGACCTGGAAACCATGCCAGATGAGCTTTTGGCCACGTTGGATGACACATGTGATCTTTTTGCCCCTCTAGTCCAAGAGACTAATAAGGAGCCCCCTCAGACAGTGAACCCAATTGGCCATCTCCCAGAAAGTGTAATAAAAGTCGACCAGGCTGCCCCCTTTACATTCTTGCAGCCTCTTCCCTGTTCCCCAGGGTTTCTGTCTTCCACTCCAGATCATTCCTTTAGTTTAGAGCTGGGAAGTGAGGTTGATATCTCTGAAGGAGATAGGAAGCCTGACTCTGCTGCTTATATTACTCTAACCCCTCAGTGTGTAAAGGAGGAAGACACTCCCTCTGATAGTGACAGTGGCATCTGTATGAGCCCTGAGTCCTACCTGGGCTCTCCCCAACACAGCCCTTCCACCTCCAGGGCCCCACCAGACAGTCTGCCTTCTCCAGGTGTTCCTCGTGGTTCTCGACCCAAACCTTATGACCCACCTGGAGTTAGTGTGACAGCTAAAGTGAAGACTGAAAAGTTGGATAAGAAGCTGAAAAAGATGGAGCAAAACAAGACAGCAGCTACTAGGTACCGCCAGAAGAAGAGGGCTGAGCAGGAAGCCCTCACTGGCGAGTGTAAAGAGCTAGAAAAGAAGAACGAGGCTCTGAAAGAGAAGGCAGATTCTCTCGCCAAAGAGATTCAGTATCTAAAAGACCTGATAGAAGAGGTCCGTAAGGCAAGGGGGAAGAAGAGAGTTCCTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T53270-Ab Anti-ATF-4 monoclonal antibody
    Target Antigen GM-Tg-g-T53270-Ag ATF-4/ATF4 protein
    ORF Viral Vector pGMLV000321 Human ATF4 Lentivirus plasmid
    ORF Viral Vector pGMLV000496 Human ATF4 Lentivirus plasmid
    ORF Viral Vector pGMAAV000923 Rat Atf4 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMPC000693 Human ATF4 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000321 Human ATF4 Lentivirus particle
    ORF Viral Vector vGMLV000496 Human ATF4 Lentivirus particle
    ORF Viral Vector vGMAAV000923 Rat Atf4 Adeno-associate virus(AAV) particle


    Target information

    Target ID GM-T53270
    Target Name ATF-4
    Gene ID 468, 11911, 703965, 79255, 101084297, 474503, 509107, 100070334
    Gene Symbol and Synonyms Atf-4,ATF4,C/ATF,CREB-2,CREB2,TAXREB67,TXREB
    Uniprot Accession P18848
    Uniprot Entry Name ATF4_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000128272
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a transcription factor that was originally identified as a widely expressed mammalian DNA binding protein that could bind a tax-responsive enhancer element in the LTR of HTLV-1. The encoded protein was also isolated and characterized as the cAMP-response element binding protein 2 (CREB-2). The protein encoded by this gene belongs to a family of DNA-binding proteins that includes the AP-1 family of transcription factors, cAMP-response element binding proteins (CREBs) and CREB-like proteins. These transcription factors share a leucine zipper region that is involved in protein-protein interactions, located C-terminal to a stretch of basic amino acids that functions as a DNA binding domain. Two alternative transcripts encoding the same protein have been described. Two pseudogenes are located on the X chromosome at q28 in a region containing a large inverted duplication. [provided by RefSeq, Sep 2011]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.