Mouse Ccl26/Ccl26l ORF/cDNA clone-Lentivirus plasmid (NM_001013412)

SKU: pGMLPm004546
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Mouse Ccl26/Ccl26l Lentiviral expression plasmid for Ccl26 lentivirus packaging, Ccl26 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf MSDS
pdf Datasheet
pdf Terms of Use
pdf Map
Purchase
Total Price: $495
Shipping fee: Limited-time free


Product Description

Catalog ID pGMLPm004546
Gene Name Ccl26
Accession Number NM_001013412
Gene ID 541307
Species Mouse
Product Type Lentivirus plasmid (overexpression)
Insert Length 282 bp
Gene Alias Ccl26l
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTTCTTCGATTTGGGTCTCCTTGTTCTCCTGGCCATCTTCCTCAGTGTCCAGCTTGGTGTTGCCACATGTGGGAGCAGCATCGCTATGTCCTGCTGCCCTAATTTCAGCTACTATGTGATCCCATGGAGCTGGGTGTACAGCTATAAGTTCACCGACAAGAGCTGCACCAGTGACGGTGTGATATTCTTTACAAAAACAGGTAAGCAATTCTGTGTCCAGCCAGGGGCCAAATGGGTGCAGAGATTCATCTCTCTGGTGAACACCAGGAACCATTTGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    ORF Viral Vector vGMLPm004546 Mouse Ccl26 Lentivirus particle




    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.