- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
Sample Application
- • Animal health test
- • In-vitro diagnostics
- • Food & Feed Safety
- • Environmental Safety
- • New drug discovery
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Mouse Pla2g1b/Pla2a/ sPLA2IB ORF/cDNA clone-Lentivirus plasmid (NM_011107)
Pre-made Mouse Pla2g1b/Pla2a/ sPLA2IB Lentiviral expression plasmid for Pla2g1b lentivirus packaging, Pla2g1b lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Product information
| Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
|---|---|---|---|
| pGMLPm002212 | Mouse Pla2g1b Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
| GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
| High Quality (HQ) Grade | |||
| Seed | 5ug |
Product Description
| Catalog ID | pGMLPm002212 |
| Gene Name | Pla2g1b |
| Accession Number | NM_011107 |
| Gene ID | 18778 |
| Species | Mouse |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 441 bp |
| Gene Alias | Pla2a, sPLA2IB |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| Sequence | ATGAAACTCCTTCTGCTGGCTGCTCTGCTCACAGCAGGCGCTGCTGCACACAGCATCAGCCCTCGGGCTGTGTGGCAGTTCCGCAATATGATCAAGTGCACCATCCCCGGGAGTGATCCCCTGAAGGATTACAACAACTATGGCTGCTACTGTGGCTTGGGCGGCTGGGGCACCCCAGTGGACGACTTAGACAGGTGCTGCCAGACTCATGACCACTGCTACAGTCAGGCCAAGAAGCTGGAAAGCTGTAAATTCCTCATAGACAACCCCTACACCAACACTTACTCCTACTCATGCTCCGGGAGCGAGATCACCTGCAGCGCCAAAAACAACAAATGCGAGGACTTCATCTGCAACTGTGACCGTGAGGCCGCCATCTGCTTCTCCAAGGTCCCGTACAACAAGGAATACAAAAACCTTGACACCGGGAAATTCTGTTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| ORF Viral Vector | vGMLPm002212 | Mouse Pla2g1b Lentivirus particle |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
