Mouse Tslp ORF/cDNA clone-Lentivirus plasmid (NM_021367)

Pre-made Mouse Tslp/ Lentiviral expression plasmid for Tslp lentivirus packaging, Tslp lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLPm000289 Mouse Tslp Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLPm000289
Gene Name Tslp
Accession Number NM_021367
Gene ID 53603
Species Mouse
Product Type Lentivirus plasmid (overexpression)
Insert Length 423 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGTTCTTCTCAGGAGCCTCTTCATCCTGCAAGTACTAGTACGGATGGGGCTAACTTACAACTTTTCTAACTGCAACTTCACGTCAATTACGAAAATATATTGTAACATAATTTTTCATGACCTGACTGGAGATTTGAAAGGGGCTAAGTTCGAGCAAATCGAGGACTGTGAGAGCAAGCCAGCTTGTCTCCTGAAAATCGAGTACTATACTCTCAATCCTATCCCTGGCTGCCCTTCACTCCCCGACAAAACATTTGCCCGGAGAACAAGAGAAGCCCTCAATGACCACTGCCCAGGCTACCCTGAAACTGAGAGAAATGACGGTACTCAGGAAATGGCACAAGAAGTCCAAAACATCTGCCTGAATCAAACCTCACAAATTCTAAGATTGTGGTATTCCTTCATGCAATCTCCAGAATAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    ORF Viral Vector vGMLPm000289 Mouse Tslp Lentivirus particle




    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.